Chershoee
S.No. sequence Rank Name Orientation Start end size Score 5`Stem 3`Stem
1 CTGTGTGCTGGCGAGGCCAAGCCGGCGGTAAGCCAGCCGGTGAGGCAGCGTTGCGTCACAG 378 MD2 Direct 422 482 61 125.3 CAAGCCGGCGGUAAGCCAGCCG CGGUGAGGCAGCGUUGCGUCAC
2 GAACAAGAGGAAAAAATGATTCTTCATCGTCGTTGTTGGGATCACCATAAGCTCTATGATGATGCTGAATGCGTGATGGTTCCGAGTTTTGTTTTGTGTTTTTTTCTTTCCTTC 237 MD22 Direct 3012 3125 114 134.2 CACCAUAAGCUCUAUGAUGAUG AUGCUGAAUGCGUGAUGGUUCC
3 AGGATGGCACGCTGCGTGGCGACAAGGGCAACAGCAACCCGAGCGGTGTGTGCGTGTTCGGTGATTGTTGTAGTTTGTCGGAACCGTTTCATCTT 83 MD25 Direct 3177 3271 95 150.1 ACAAGGGCAACAGCAACCCGAG GUGUUCGGUGAUUGUUGUAGUU
4 CGGCCGTGTATTCCTTCACCACCCAGAGCCACATGAGGATCCCGTCGCGGGAACGGACCCACATGGCGGCGGAGGGTGGGGGGTCGAGACACGGGCG 135 MD52 Direct 5597 5693 97 142.7 CACCACCCAGAGCCACAUGAGG GACCCACAUGGCGGCGGAGGGU
5 ACCAGGGCATGGCGTGGGATCGTGAGAGTGTGACGGTGTTTTGAGTTAGAGCTAGCGGGTACCGGAAGCTTTTCACGGACTACTACACCGAGTTCCAGGGT 499 MD62 Direct 6483 6583 101 119.8 AUCGUGAGAGUGUGACGGUGUU CGGGUACCGGAAGCUUUUCACG
6 CGCGGGACGTGCGAAAAGCCCGTTTCATCTGCACGCGACATTCGATGACGCTGTATAATGTGACGGTGGAAGACATGGGTATGTACGTGCTAACG 376 MD69 Direct 7470 7564 95 125.3 UUUCAUCUGCACGCGACAUUCG AAGACAUGGGUAUGUACGUGCU
7 TCTACTTCTTCATATTTTCCAGAGCCGTGTGCGAAGCCTATGCTACGCGCTGCGCCTTCTGGAAATACCTGGACAATAGA 547 MD70 Direct 7593 7672 80 117.9 UAUUUUCCAGAGCCGUGUGCGA UACGCGCUGCGCCUUCUGGAAA
8 GTATGGACTGCTAGTGGTGCTGACGTCGTGGGTGTCAGTAATCGGCGGCATCCACTAC 551 MD97 Direct 10551 10608 58 117.6 UGACGUCGUGGGUGUCAGUAAU UCAGUAAUCGGCGGCAUCCACU
9 ACTATGGGGCGGTCATATGAGGCTGTCGGGGCAGAATCTGCGTCTATCGCTGACCTGCTCGCGGCAACACCTGACGCTGCATAGT 479 MD116 Direct 12402 12486 85 120.8 UAUGAGGCUGUCGGGGCAGAAU ACCUGCUCGCGGCAACACCUGA
10 GTTCTAGTGATACTGTTTTGCCTACGTATCCCACAGAAACTGTACGATAAGTGGCGGAACAGGCGTCGGTACGGGC 122 MD134 Direct 14201 14276 76 144.4 CAGAAACUGUACGAUAAGUGGC GAUAAGUGGCGGAACAGGCGUC
11 TGGTAGACACGGAACTGTGACCAGTCCGGTTAATCATAGTAATGTTTTATACCTTTTCTGTATTAACTTATGTGTGTAATAAATTGCACGAAGTACCACGAGAGGTAGAATGTAATAAGGTTACGGGATACATCGGTCAAAATGTTAGTCTAAAGTCCA 318 MD135 Direct 14286 14444 159 129.0 UGUGACCAGUCCGGUUAAUCAU ACGAAGUACCACGAGAGGUAGA
12 GACTCAAGCATATATACACGGCTCGGGGAGCAAGGTGTGACTGTGGTCGTGTGTGGTGTCTCTGGTC 232 MD175 Direct 18640 18706 67 134.4 AAGCAUAUAUACACGGCUCGGG UGGUCGUGUGUGGUGUCUCUGG
13 CGCCATGGCCGGCGCGATCCGGCTGTGGCTGCCGCTGGCGGCGGCGATCGTGGCGGCGGTGGCG 188 MD176 Direct 18715 18778 64 137.4 UGGCCGGCGCGAUCCGGCUGUG GGCGGCGAUCGUGGCGGCGGUG
14 GCTGGCGGCGGCGATCGTGGCGGCGGTGGCGCCGACGGGTCGCTGCTGCGACGGCTGGTGCCCCCCGCCGATACTGCGTTCGCCCTGCCTGC 222 MD178 Direct 18748 18839 92 135.1 UGGCGGCGGUGGCGCCGACGGG CGGCUGGUGCCCCCCGCCGAUA
15 CACGGCGCTGGTGGCCGACGTGCACGAGCTGCAGAAGACGGATCGCTCGTGCGACCTGGCTTTCGGCTCGCGCACGCAAACCAAGTACCTGTG 480 MD184 Direct 19189 19281 93 120.7 CACGAGCUGCAGAAGACGGAUC UGGCUUUCGGCUCGCGCACGCA
16 AACCAAGTACCTGTGGACGCCCGATCCCAGCAAGTTACGTAGCCGAGATTGCGGTTGGGAGGGTGAACGTCATCGCTTGGTT 426 MD185 Direct 19267 19348 82 123.1 AAGUUACGUAGCCGAGAUUGCG AGAUUGCGGUUGGGAGGGUGAA
17 CTCACTATATATCGGACGCTGTTTCTGTACGATATACTGTTAATAAAACGTTAAGATGTTTGTAACGTGTGTGGTAACGGTGTCTGTGTGTATCTGGTGGG 64 MD202 Direct 21368 21468 101 154.5 UAUACUGUUAAUAAAACGUUAA UUGUAACGUGUGUGGUAACGGU
18 GGTGACATGCAGCTTCAGCGAGGCCGTGATGATCGACGAAGTTCGTTACTTTGCCTTTATCGCAGAAATGTCCTTCATCGGCATCACGGGTTTCACCTGCCTCATCACC 571 MD227 Direct 23567 23675 109 116.8 UGAUGAUCGACGAAGUUCGUUA AAAUGUCCUUCAUCGGCAUCAC
19 GGATCTCCCTCGGCAGGTCCATCGGTATCGCTTCCTCGTCCCCTCCGGGCACAGCGACGATCCGATGAATCGGCGGCGGGACC 470 MD237 Direct 24301 24383 83 121.3 UCCAUCGGUAUCGCUUCCUCGU AGCGACGAUCCGAUGAAUCGGC
20 GCATCTGTGTCCTTTATCGGCGAGCGTCGGACGCACTGTTGTTTTCCCATGGCCTGTGTAACTAGCCTTCTAGTGAAAGTTACCGAAAACGCATTTCACTAGAACGCTGGTTCAGAGGCTATGTGTGACTTGGTTCCTCGGCGCCGGACACCCTGC 541 MD248 Direct 25269 25424 156 118.1 AUGGCCUGUGUAACUAGCCUUC CACUAGAACGCUGGUUCAGAGG
21 ACGGCGGACGCTGTTGTGCAGGCGGCCGCGGGGACAGGTGGGCTTGTTCATCCTGCGCATCCCCTTGGTACCGTAAAACATGCCGTTGT 163 MD249 Direct 25576 25664 89 140.3 GGACAGGUGGGCUUGUUCAUCC UUGGUACCGUAAAACAUGCCGU
22 GCTGTGATCGCCCAGGACGATGGTCTGCCCGCTGTACATGTTCCGCCAGGTGGCAAAATCCAAGATGTGCTTGCAGGCGGCCAGGGTCTTGAGTTTGGCGTTCTTGGGC 566 MD254 Direct 25897 26005 109 117.1 GAUGGUCUGCCCGCUGUACAUG UGUGCUUGCAGGCGGCCAGGGU
23 GTCTGGGCGTCACGCGTTGTCGCATGAGCGCGCGGTTGACGTAGAAGGCCGACTCCGAGATCGGCCGGCCGTTGGCGTCGCGCTGCAGGTCCGCGCGGTTGCCGTGGCGCAGCTGAC 132 MD300 Direct 30191 30307 117 143.2 CGCGGUUGACGUAGAAGGCCGA UCGGCCGGCCGUUGGCGUCGCG
24 GGTCCGCGCGGTTGCCGTGGCGCAGCTGACCCTGGCGGGCGCGCTCCACGTCGTCGAAGTAGCTCTTCAGCAGACCGCGCTCCAGCAACTGCGCCAGCGAGTCGGCGGCGCGCACC 277 MD302 Direct 30278 30393 116 131.5 UUGCCGUGGCGCAGCUGACCCU AGACCGCGCUCCAGCAACUGCG
25 ACGTCGAGAAAGTCGCAGAAACTCTCCACGAAGCCGTCCACCGTAAAGCGAACGCGCTTCAGATCGTGGACGTGCTTGCGGAACCGCGACAGTTCCCGGCGT 536 MD316 Direct 31232 31333 102 118.2 CUCCACGAAGCCGUCCACCGUA CAGAUCGUGGACGUGCUUGCGG
26 CGGGTCGGGCATGGTGGGGATGGCTCGCAACGCGGCCCAGACGGCCAGGTCCCACTCGAGCGTCAGGCCCCGGATGTCATACTTGCCGTGAGCCGTGACCTCGGCCGAATGGGCCAGACAGCTGCGGCGCACGTAGACCATGGCGTGCTTGGAACG 606 MD330 Direct 32227 32382 156 115.6 CGCAACGCGGCCCAGACGGCCA UGCCGUGAGCCGUGACCUCGGC
27 CTCGTCCTTAGCATGCTCCTGCTGTGGCTCTGGTGTCTGTACCTGCGACTGCTGCAGTTCCGTCATCGCGGCGGCGCAGACGACGGCGGAAAGTCGAGCAAGGAGCTGCCGGATCGAG 33 MD336 Direct 32611 32728 118 164.1 UGCUCCUGCUGUGGCUCUGGUG CGCGGCGGCGCAGACGACGGCG
28 GCGGGCCTTCTCCAGCACGCCGATGACGAAGCCGTTGGCCTCGTCGGCCTCGGCCACGTTCCACGAACCGAAGGTGAAGGTGCAGGCCGGCGAGCCGCCCAGACGGATCTTGCAGCCGGCGTTGAGCTGGCACACGC 430 MD338 Direct 33159 33295 137 123.0 GGCCUCGUCGGCCUCGGCCACG AGGUGAAGGUGCAGGCCGGCGA
29 GGCCAGGTGAGGATCAGCTGGGCGTCGCGGTGCGACTCCACGTAGGCGCTGCGGGCCTGGGGGTCGTCGCCGCAGGCC 224 MD353 Direct 34441 34518 78 135.0 GGAUCAGCUGGGCGUCGCGGUG CGCUGCGGGCCUGGGGGUCGUC
30 GACGCGGTCATCTTTGGTGCCGTACCCACTGCAGCTTTACCGGCGTGGGTGGGTTTCAGAGACGGTTGCGGTC 522 MD396 Direct 38148 38220 73 118.9 UCAUCUUUGGUGCCGUACCCAC GUGGGUGGGUUUCAGAGACGGU
31 AGAAGACTCACGGAAGAGCGATGGAGATCCCCTCCGAGTTCGCATCGGAGTCCTGCCGGCGTCGGCGGTCCTGCCCTGGGTGGCGGCGTCTCGCAATGCTTTTTGTTTTCT 281 MD415 Direct 39572 39682 111 131.5 CGGAAGAGCGAUGGAGAUCCCC CGUCUCGCAAUGCUUUUUGUUU
32 GCACGTTGATGATCACGCGGCCGGTGTAGACCAACTTATTGACCTCGTTGATTAGCGGCGCGT 608 MD427 Direct 40159 40221 63 115.6 UUGAUGAUCACGCGGCCGGUGU UGACCUCGUUGAUUAGCGGCGC
33 CACCAACGCTTCCTATCACACCTGCGTCATGTACTTCGTAGCCGACGAGGTATACACGGTGCTCATGTCCTGGAAAGTGTTGCTG 185 MD439 Direct 41582 41666 85 137.8 GUACUUCGUAGCCGACGAGGUA UCAUGUCCUGGAAAGUGUUGCU
34 GAGCGCTCGGCGCTGGGCGTGGAGGTGCACGCGCTGGTGGCGCTGCTGCCGCACGAGCGCCACCGCGACCTGTGCAACGTGCTC 291 MD454 Direct 43173 43256 84 130.8 UGGGCGUGGAGGUGCACGCGCU GCACGAGCGCCACCGCGACCUG
35 AGATGCGTCCCTCGGCCTCCTCGTGCGAGGGTATCCGGCGGGGCTGCGGGGGCTGGTCGGCCTCGTCGTCGTCCTCGAACATGGCCATGGGGTCGGGGGTCTTCT 140 MD501 Direct 46454 46558 105 142.0 GGCUGCGGGGGCUGGUCGGCCU CGGCCUCGUCGUCGUCCUCGAA
36 GTGGGTGTCGGGGCACTCGTCGAAGGGGTCGTCGATGACGTAGGAACGGTATCCCCTCCTGGCGATCTCGGCCGACATGCTCTCGACGTCGCTGCGGTACAGC 503 MD506 Direct 46941 47043 103 119.6 AAGGGGUCGUCGAUGACGUAGG UGGCGAUCUCGGCCGACAUGCU
37 CTGAGAAGAGAAAAAGCCACGTACGTTGAAGACACCTGGAAGGAGCGTGCCGAGCGAACGTCCTCTTTCCAGGTGTCTCCAACGTCGTGGGCTTACCTTGAGAGCAG 25 MD513 Direct 47306 47412 107 167.8 ACGUACGUUGAAGACACCUGGA UCCUCUUUCCAGGUGUCUCCAA
38 GCAGCGTGTCCCGGAGGTCGTCCATGTCGAGCGGGGAAGACGGCGAGCGGGCCACGGTGGCGGTCGGAGTCCTCCTCCTGCTGCTCTTGCTGCTACTGCCCCTCTCGCTTCTTCACGCTCCGCCGCTCCCGCCGGCTCCTGAGATGCTGT 7 MD519 Direct 47579 47728 150 182.3 CACGGUGGCGGUCGGAGUCCUC UUGCUGCUACUGCCCCUCUCGC
39 CAGCATGTTGGGAGGTGCGGACAGGACCCGGTGGACCGTCGGACGGGGGGCGATATCCACAAAGTGCGCGTGGTGACCGCGGCGCCGCTGCTGCGGGGACTGTTGCGATTGTCGCGGCTGCTGCTGGGGCTGATCCGTGACGATTAGCGAATTGGCCCGCAGCGAGTCGCGGTCCACGAAGGCGACGGGCATCTTACCCTCTCGGATCCTGCGCTCGGCCTCTAGGATGGCCCGCACGTAGCAGTTG 306 MD535 Direct 49098 49344 247 129.6 UGGACCGUCGGACGGGGGGCGA GCCCGCAGCGAGUCGCGGUCCA
40 TCGCGGCTGCTGCTGGGGCTGATCCGTGACGATTAGCGAATTGGCCCGCAGCGAGTCGCGG 545 MD536 Direct 49209 49269 61 118.0 CGGCUGCUGCUGGGGCUGAUCC AAUUGGCCCGCAGCGAGUCGCG
41 GGCTGCCCACGTCCACCTGCGCCTGCTGCCGCTCGGCCTCGTCCAGCATGCTCATGATGGCGGTCGTGGCGTGCGTGGTGGCGACGGCAGCC 166 MD541 Direct 49874 49965 92 140.0 UCCAGCAUGCUCAUGAUGGCGG AUGGCGGUCGUGGCGUGCGUGG
42 CGGAGCCGAAAGCCGCGTGTCGGTGACACGTCGTCTTGAGACGGTGTCTTATATATCTTCTTAAGACGCCGGACATGACGCGCCCAAGACACGTGGATTTTGGCCTTG 57 MD554 Direct 50509 50616 108 155.5 UCGUCUUGAGACGGUGUCUUAU CAAGACACGUGGAUUUUGGCCU
43 TTGTACGTATGTCGTGACTGTCGCGCGTGTCCTTGAACGTCAGATACCGGTACTGACGCGAGGACCCGACAGCTTACGAGACATTGAGCAA 295 MD557 Direct 50691 50781 91 130.3 ACUGUCGCGCGUGUCCUUGAAC CGCGAGGACCCGACAGCUUACG
44 GATGGCTGTTACACGTGCCCGTCCGGGTCTTGTTACCCACGTCGATCAGCAACTCGGGTTTCTCGGAGTTGTTGTCCTTGGGTCGGCAGCACTGGACGTCCACGGTCATC 498 MD564 Direct 51288 51397 110 119.8 UGUUACCCACGUCGAUCAGCAA GUUGUUGUCCUUGGGUCGGCAG
45 CGCGGCCTTCTTCGTCGCGGAGGATGGGAGTGGGGTCCATCGCGTGGCGGTTTCTTCTGTTGCGGCTGTCGCGTTATCCCTTTCACCGTCGAAGCAACGGCGACGACGACAAGGTGGGCGGTAGAGAGCGCGGCGAAGAAGAGCCGCCAAAGAGGCCCCTCTTCTTCCGCAGACGCCGGCAGAAGACGTCGCG 454 MD582 Direct 52449 52641 193 121.8 CGGUUUCUUCUGUUGCGGCUGU CCAAAGAGGCCCCUCUUCUUCC
46 GGCCCGCCCGAAGAGGCAGTACTGCGGCTGACGGCCGCGGTAGCGTTTCATCAGCAGGCT 567 MD625 Direct 56537 56596 60 117.0 UACUGCGGCUGACGGCCGCGGU CGGUAGCGUUUCAUCAGCAGGC
47 GCCACGCTGCAGGCGGCGCGCCAGCCGCTGGACGCCGCGCAGCACTTGTACGACCACCTGGAGAAGTTCGTGGCACGCGACAGCGGCGCCGCCGCCGGCAGCGAGC 271 MD667 Direct 59412 59517 106 132.1 UACGACCACCUGGAGAAGUUCG CGGCGCCGCCGCCGGCAGCGAG
48 GTCCGGCGCCGCGGGGGTTTCGTCCGAGAAGCGCGCCAAGAAGGACGGTAGTGGCGGCGGCCCCGGCGGCGACCGCGGC 508 MD672 Direct 59621 59699 79 119.5 CGCGCCAAGAAGGACGGUAGUG GUAGUGGCGGCGGCCCCGGCGG
49 TGGTGACGCGACTGCTGAGCGAGGAGGTGTCGAGCACGCAGGCCTCGCGCCAACGCCTGGAGCCGCTACAGACAGTGTGCGCGCGGATCATCGATCGATACTTCGCCAGCCAGCTCAAGGTCACCA 421 MD678 Direct 60181 60306 126 123.3 CUGCUGAGCGAGGAGGUGUCGA AUCAUCGAUCGAUACUUCGCCA
50 GCAGTTCTCGGAGATCTTCGGCATCCCGCAGGGTCAGTTCGAGACGGTGGGCTCACCACGTCTCATGACGCTCATCCAGCTGTGCCGCATCCTGATGC 388 MD693 Direct 60947 61044 98 124.8 CCGCAGGGUCAGUUCGAGACGG UCUCAUGACGCUCAUCCAGCUG
51 TGTCGACCTTCGTGCGCGGCCTGCAGGCCCTGGAGCGTCACGTGCTGTCGGCGTTGACCTATCTGACGGAACAGGTGAACCAGTGCCCGGCCATCGTGCCGCGACTGGACGACA 455 MD761 Direct 66717 66830 114 121.7 CUGGAGCGUCACGUGCUGUCGG UGACGGAACAGGUGAACCAGUG
52 AGAACGTGGTCTCGGTCAAGTACAAGGCAGTGACGGTGTCCGTGGCCATCGCGCAGACCCTCAAGGCTTTCTGGCCCCAGATCACGCGCT 348 MD766 Direct 67077 67166 90 127.0 UACAAGGCAGUGACGGUGUCCG AGACCCUCAAGGCUUUCUGGCC
53 GTGGACGGAGACGCCGTACGAGCAGTGCTGGTATCAGGCGCAGGTGCTGCGTCTGCGCCAGTACCTACGTCATCCCGTGCGCTTCGTTTAC 85 MD778 Direct 68188 68278 91 150.0 AGGUGCUGCGUCUGCGCCAGUA CGUCUGCGCCAGUACCUACGUC
54 CGCTCCCGACGCCCGCCGCGGCCGCGCTAGACATACCCGACGTCGGCGGCACTCCCGCCGCCGCTCGGGTTCCGCTGGTGCTGGTGATGATGGTGGCCGACGTGGCAAGCG 239 MD793 Direct 69239 69349 111 134.1 UCGGCGGCACUCCCGCCGCCGC CCGCUCGGGUUCCGCUGGUGCU
55 GCTGCGGCTGGTGCTGCAGCTGCTGCTGGAAAACCGACGGCGTCTGCGCCGCAAGCTGCGTCGGCGCCTGCGCCGGATGTACCGGCACTTCGTCCAGCTGCAGCGCGCCGCGGC 316 MD812 Direct 70725 70838 114 129.1 CGGCUGGUGCUGCAGCUGCUGC CGGCGCCUGCGCCGGAUGUACC
56 GGCTGGAGACCGGCGGAGGATAGTCCCTCGAGCGCCCAAAGCGCGGCGCCATGGGCCGACGTTGCTGATCGTAGTCGCGTCGACGACGCACGTCGCTCTTGGGGGACGTCGGGGGACTCGTCGCCGCCTCCTCCTCTGCT 254 MD818 Direct 71092 71231 140 133.2 AUAGUCCCUCGAGCGCCCAAAG CGUCGACGACGCACGUCGCUCU
57 GGGCGCCGTGCAGGACGACGTGGCGCGCCACGGGGCCCAGGTGCCGCTGGCCGACTGCGCCGCGGCGCCCGGCGCGCGGCCC 464 MD851 Direct 74202 74283 82 121.5 CGCCACGGGGCCCAGGUGCCGC GCUGGCCGACUGCGCCGCGGCG
58 GCGGCGGCGCGGCGTCCCGCGGCCGGCGCGCCTCGCCGCCGCGCCAACAGCGGGGTGGTGCGCGGGACCCTGGAGCGCCGCTCGGCCCTGC 107 MD856 Direct 74660 74750 91 146.2 UCCCGCGGCCGGCGCGCCUCGC GGUGGUGCGCGGGACCCUGGAG
59 CTGTAGGGCAGAAAGGCCGCCTCCAGGTGCAGACGCCGCGGCAGCACCATGCTGAGGAACCTGTCCTTGCGGCCGATCTCGCCCTCGG 596 MD867 Direct 75838 75925 88 115.9 CAGACGCCGCGGCAGCACCAUG AGGAACCUGUCCUUGCGGCCGA
60 CCCTGGTGGCGCCAGTCGTAACGGTTGACGGAGCACCAGCCGAAGGTGGTGATCCGCCGGTCGATGACCAGGCGCGTCAGGG 96 MD909 Direct 78895 78976 82 147.8 GCACCAGCCGAAGGUGGUGAUC UGAUCCGCCGGUCGAUGACCAG
61 TCTGGCCATGCTCCAGTTACTGATCGACACACACTGCAGGTCGGGCACGGGCCGCGTACCGTAGCCGTAGATGGAGGTCTTGGTGGCCGGCGTGACAGA 504 MD911 Direct 79035 79133 99 119.6 GAUCGACACACACUGCAGGUCG UACCGUAGCCGUAGAUGGAGGU
62 GCCGCTACTGCCGCTGCCGCCGCCATCGAACTTGCCGGGGCGACCGCGGCGCCTCGGCGTCGTCTGCTGCTGCAGCGGCGACTGTTGCG 440 MD918 Direct 79668 79755 88 122.4 GGGCGACCGCGGCGCCUCGGCG UCGGCGUCGUCUGCUGCUGCAG
63 GCTGCGCGACTGGATCATGTAGGGGAAGAGCTGCTCCAGCGGCTGCATGTACATGCGACGTTGGCGCGTGTAGATCAAATAAATGATAACCAGTACGGCCAAGGC 467 MD926 Direct 80408 80512 105 121.4 UGCAUGUACAUGCGACGUUGGC AAUGAUAACCAGUACGGCCAAG
64 CGTGTTCTCCAGCGGATTGATGTCCAGCGCGATCATGCTGTCGACCGTGGCGATAGTGCTGAGGTCGATCATGCGCTTGAACATG 345 MD929 Direct 80816 80900 85 127.3 UUGAUGUCCAGCGCGAUCAUGC GGCGAUAGUGCUGAGGUCGAUC
65 GGATTGATGTCCAGCGCGATCATGCTGTCGACCGTGGCGATAGTGCTGAGGTCGATCATGCGCTTGAACATGTAGTCC 557 MD930 Direct 80829 80906 78 117.4 CGCGAUCAUGCUGUCGACCGUG AGGUCGAUCAUGCGCUUGAACA
66 GTAGGACGAGTTGCCGGCGATGAAGATCTTGAGGCTGGGTAGCTGGCACTCCTCGGTGCGGTGGTTGCCCAACAGGATCTCGTTGTCCTCACCGAGCTGCCCGTACTGC 172 MD932 Direct 80915 81023 109 139.4 AAGAUCUUGAGGCUGGGUAGCU GUGGUUGCCCAACAGGAUCUCG
67 GGATGGTGCGGTCTGAACTCTCCCAGTAGGCGTACTGACAGGTGGTATTCTGCTCATCTTCCACGTCCCAGGAGAGCACGGAGTCGCCCCGCTCCA 407 MD940 Direct 81730 81824 95 124.0 CAGGUGGUAUUCUGCUCAUCUU CUUCCACGUCCCAGGAGAGCAC
68 GTCACCGTCACCATGCAGTTAAGGCTGCAGGTCTCGCGGTAGAGCCAGGTGCTGCCGCGGGTGTGGTACTGCTCCTTGACGGTGAC 460 MD942 Direct 82029 82114 86 121.6 CGCGGUAGAGCCAGGUGCUGCC CCGCGGGUGUGGUACUGCUCCU
69 TAGCGGGTGCTATGGGTGTTGGAGTAGTCGTCGGGGATGAGCTTCATGGTCTTGTTCTCGTAGCTGTCCTCGTGATAGGCCACAAAGACGGTGTCCCCCATGACCTTGCTGTAGGAATTGTAGCACTGTCCGTTG 335 MD943 Direct 82116 82250 135 128.1 UAGCUGUCCUCGUGAUAGGCCA UGAUAGGCCACAAAGACGGUGU
70 GCGTGACGTTGTGGACGCGCGAGCGGGCGTCCAAGGGGTCCAGGGCCTCGTGCTCCTCCTCACCGCGGGGGGCCTGGGACAGGGTGGCGGCGCCCCCCGCCGCGCTCCTCCGACCGCGC 203 MD971 Direct 83771 83889 119 136.2 UUGUGGACGCGCGAGCGGGCGU GGGGGGCCUGGGACAGGGUGGC
71 GAGCACGCAATCGGGCGGCACGTCGATGAGGTCGTGATCGTTGTAGTCGCTGGTGACGTGCACCAGGAACTTGACGAAAGCGTTGAAGTCGGCCATGTCGCCGATGGGCACGTTC 342 MD1006 Direct 86513 86627 115 127.9 CAAUCGGGCGGCACGUCGAUGA AGGAACUUGACGAAAGCGUUGA
72 GGAGAGCAGCGGGTGGAAGGCGGCGGCGTAGGGGTTGAGGTCCAGGTTGAAGGCCTGCGTGGCGCCCACCACCTCGTCGCGACTGCTCTTC 373 MD1012 Direct 87146 87236 91 125.4 UGGAAGGCGGCGGCGUAGGGGU AGGCCUGCGUGGCGCCCACCAC
73 GCGGGTGGAAGGCGGCGGCGTAGGGGTTGAGGTCCAGGTTGAAGGCCTGCGTGGCGCCCACCACCTCGTCGCGACTGCTCTTCATGCGC 317 MD1013 Direct 87154 87242 89 129.1 GGCGUAGGGGUUGAGGUCCAGG CGUGGCGCCCACCACCUCGUCG
74 GCGGCGGCCGAAGGTGCCCAGCACATCCACGTCGCTGAGAAAGCGCGACTGCATGACCACCACGCAGGGCTCGCGCTTGGGCAGCTTGTGGATGACGGGCAGGCGGGTGCGC 438 MD1017 Direct 87569 87680 112 122.5 ACGUCGCUGAGAAAGCGCGACU CUUGUGGAUGACGGGCAGGCGG
75 CGCACCGAGCCGAGGTTCGATCCCCAGGCGCCATCTGGTGGCGGATGAAAAAGCCGCGTCTCTGGCGGCCGTTCGGGGTTCAACCGGCGGGTGGCGCTGCGGGGACACGTTGTTTCGGTCCAGCG 538 MD1041 Direct 89997 90121 125 118.2 AUCUGGUGGCGGAUGAAAAAGC UGGCGCUGCGGGGACACGUUGU
76 GCATGCGCGGCACAGTGCCAACGCGAAGCGCGCATGCGCACGTTGAACTGCGCATGCGTCGGCGTCGGTGTTGTTGCCGGGCAACGC 220 MD1057 Direct 90945 91031 87 135.2 UGCCAACGCGAAGCGCGCAUGC CGCAUGCGUCGGCGUCGGUGUU
77 CACGTAACTTGTTACTGCGCATGCGATTTTTGTCGGCGTGGTTTATGGGATGGCGACGGTTACCTGGCAACCACGTTGAAAGTGATCTGCGCGTGCGCCGCACCGTGTCGGCGTG 173 MD1058 Direct 91031 91145 115 139.3 UGGUUUAUGGGAUGGCGACGGU UACCUGGCAACCACGUUGAAAG
78 TCCCGTAATACTCCGCGATCAGTTACCGTGGCGACGTTTCAGGGCGCATGCGCCTCTGGAAGCGGTACCGCGGGCGCGTCGTGGGCACAGTACGGGG 78 MD1061 Direct 91226 91322 97 150.9 CAGGGCGCAUGCGCCUCUGGAA UGGAAGCGGUACCGCGGGCGCG
79 CGTCCGGGACACGCATCTGCGCATGCGCGGTCTCGGTTACTATACGCGCGTATGCGTGTGCGCGCGGGGGCACGCGCAGGCGAGGTGCTGGTCGGGAGGACG 314 MD1062 Direct 91356 91457 102 129.3 GCGCGUAUGCGUGUGCGCGCGG GCGGGGGCACGCGCAGGCGAGG
80 CATGCGCCTGGGGGCTTTCTATGCGCGCATACGCGCGCAGCTCGCGGGTGTATGCGTGGGTGGGGGATGGGCACCAACAACAGGCAATG 352 MD1066 Direct 91527 91615 89 126.8 GCUUUCUAUGCGCGCAUACGCG UGUAUGCGUGGGUGGGGGAUGG
81 GCGACCACGGACGGACGGACCCCCGGATCCAGGACGGCGGCGGCGATGCGGTGGACCCGGCGGCGGACCCCGTGGCGGCGAGGGCGGAACCCGGCGGCCGATCCGGCGCGAACGGAGCGGGAGCGGCGAGGCGCGGCGGCGGCGGCGGTGGGTCCGGGGGTCCCCGGGGTGCCTCCCGTAGCGATGGCGGACCGGGGGTCGGGGGGTGCGCAGGGCGGTGCCCCGGGTCGGAACCCCCGGGTGCGGTTCGGGCGGCGGGGCTTCCCGGCTCCTTCCACCGGCTCGCCCGGGGGTCGGGGCGATGCCCTGGCCTCCCCTCCCCCGCCCCTGCTCGGGTCCCGGGGTCCCTCTACCCCCATCCCGTCGACCCTCCCTGGGTGCCGCTGCCGCTACCGGCCGGAGCCGGTCGTCAGGTAAAACCCTCCCCCACCCCCGTCCCGGATCCCATCCGCCCGCCTCGCTCCCGGAACCCTCCGTCCTGCCCGTCCGCTCGCCCGCTGCCGTC 51 MD1069 Direct 91982 92475 494 157.2 UCGGGGGGUGCGCAGGGCGGUG GCCCCUGCUCGGGUCCCGGGGU
82 GGGGTTGGCGGTTTGGGATTCGGTTTCTGGGGAGACCACCTCCGGCCGTCGCTCGACGTCCCTCTACCGGGGCTCGACGGTCGGAGGTGCCAGATCCGATCCCTCGCCGATCAATCCC 238 MD1080 Direct 93209 93326 118 134.1 ACCUCCGGCCGUCGCUCGACGU CGACGGUCGGAGGUGCCAGAUC
83 GACCCGGCTGGGGCGAAAGGTCTAAAACGCCGCCGCTAGTGGGGGGTCCGGGTTGCCAAAATTCCCCTGTCCCGGACCCCGGTCGGCCTTTTGGCTTTTCCTTCCCCTGACCGGCGTC 364 MD1087 Direct 93704 93821 118 126.4 AAAGGUCUAAAACGCCGCCGCU CGGACCCCGGUCGGCCUUUUGG
84 GTGGCTCGCGTGATGTGACGTCCGCATCCGGGATGCAGACGGACGTGGCTCTCACATCCGCGAGTAAC 240 MD1090 Direct 94007 94074 68 134.0 CGCGUGAUGUGACGUCCGCAUC CGUGGCUCUCACAUCCGCGAGU
85 GAGCTAAGTCGGGAACCTCGCCCTTCCGGAGTGACGCACATAGCTCGCCGGGGCCCGCCTTCTGTCCAGGCCGGTTCCAAAGCGGCGTGTCTGAGTCACCCGGAGGCGACGCGCAACAACCCCTCCCCCCTCCTC 369 MD1091 Direct 94086 94220 135 125.6 CACAUAGCUCGCCGGGGCCCGC UGUCUGAGUCACCCGGAGGCGA
86 GTGAGACGATGATGCCAGCTCGATCCGGGACCGCCGTAGCGGGGTGTTTTTTAATTTATTTTATATATACGCTATGTATCTACTGTTTTTCCGGGTCCTGCGCGTCGTTGCTGC 205 MD1099 Direct 94727 94840 114 136.1 UGAUGCCAGCUCGAUCCGGGAC UCCGGGUCCUGCGCGUCGUUGC
87 GTCGCTGATGATACGTCGTCCGTCCTCTCCTCCTCTGTTCTGGCTGCGTGGAGAGACGGCGGGGAATGATCGTCTCCGAT 463 MD1115 Direct 95936 96015 80 121.5 CGUCGUCCGUCCUCUCCUCCUC GUGGAGAGACGGCGGGGAAUGA
88 CGTCGTCCGTCCTCTCCTCCTCTGTTCTGGCTGCGTGGAGAGACGGCGGGGAATGATCGTCTCCGATGCGGGTTGTGGTTTCCCGAGCCGGATCAGAGCCCTCACGGATGCGGTTCGGGGACCCGCGGGGAGCGATCTCCGCTGTCGTCTCCCGCGGCGCTCACGAAAAAACTACAAACGGCGACGATGACG 355 MD1116 Direct 95949 96134 186 126.7 UCUGGCUGCGUGGAGAGACGGC UGCGGUUCGGGGACCCGCGGGG
89 AGATGTCGACGCGGACCGCTAGAGGGAGACGACATGCTTCGTTCTTCCTCAGTACTCGTCCATGTCGTCGCT 565 MD1138 Direct 98347 98418 72 117.2 AGACGACAUGCUUCGUUCUUCC UUCCUCAGUACUCGUCCAUGUC
90 CCTCGTAGTCGGGCGTCTGACAGCGCATGACGACGGATTCGGGCGAAGTGGCGCCCGAGGCTTCGGCGGCGCTGCTGCTGTTATTGTCCGGTGGTGGCGGGG 41 MD1139 Direct 98436 98537 102 159.2 CAGCGCAUGACGACGGAUUCGG CCCGAGGCUUCGGCGGCGCUGC
91 GCGGAGGGTACCTGCCGCGGGGGTGGTCGTCGTAGTCGTATTATTACTATTATTTGACGCGGTGGTAGTCGTCGT 292 MD1144 Direct 98824 98898 75 130.8 UACCUGCCGCGGGGGUGGUCGU ACUAUUAUUUGACGCGGUGGUA
92 AGACGATGGCGCCGGCTCCGGGCCGGTCCGAGGTAGGGACTTTGACGAGGTCTTGGCTGCTGCTGTCGTCT 39 MD1146 Direct 99123 99193 71 159.6 UGGCGCCGGCUCCGGGCCGGUC ACGAGGUCUUGGCUGCUGCUGU
93 CCCTCTGAATACTGGTGAGGGCTCCTTCTTTTCCTGCTCCTTCTCTCATAAGCTGTCGAGCTCTGCTTCTCCGGCCTGGGGGCTGAAGGTGGCGGCGGAGGATACGGCGGGGTCCGCGGTCCTTTGGGGG 400 MD1148 Direct 99212 99341 130 124.2 CUUCUUUUCCUGCUCCUUCUCU CCGGCCUGGGGGCUGAAGGUGG
94 CGTCGTCGCGCACCCAGCCGCTCATTTGGCCCGGCTTCTTGACCAGGCGCTTGAGCAGGTTGCAGTTGTCGCCCCAGCCCTCCTGGTGGTCGAGGATGCAGCCCAGGTCCAGGTTGCTGAGCTTGTTGAAGAGCAGCTGGCGCATGGCG 181 MD1160 Direct 99831 99979 149 138.1 CCCGGCUUCUUGACCAGGCGCU UCGAGGAUGCAGCCCAGGUCCA
95 CAGCCCAGGTCCAGGTTGCTGAGCTTGTTGAAGAGCAGCTGGCGCATGGCGGCCACCGTCTCCATGTAGGGGTCGTGCGGGTTGACCGGTAGCCCGTGGAGGTAGTGGTACTTCATGTAGCTCAGCGTCTCGTCGATGATGGCCAGCAGCGTGTGCAGGTTGGGC 194 MD1161 Direct 99929 100090 162 136.9 GUGCGGGUUGACCGGUAGCCCG AGCCCGUGGAGGUAGUGGUACU
96 GTGAGAGGCTCCGGCCGGGACTGCTCCATGCTGCTGCGTCGACTGATAAGAAGTCGGCGAGGGTGGGCTCCGCTCGCGTCGGGATTTCCGC 425 MD1185 Direct 100954 101044 91 123.1 ACUGAUAAGAAGUCGGCGAGGG UCGGCGAGGGUGGGCUCCGCUC
97 GAGAGCCCGTGCGGCTGGAAGAGCAGTACGTTGGGCGCGGTGAACTGCTCGCTCACGTGCGCCTCGTAGTGGCGCGTGAGGTGCTC 241 MD1193 Direct 101515 101600 86 134.0 AGCAGUACGUUGGGCGCGGUGA UCGCUCACGUGCGCCUCGUAGU
98 CAGCAGGCGGTGCAGCTGCGTGTCCAGGCACAGGGCGTGGTTGAGCACCTGGGCCACGGCGCGCAGCACGGCCGGGTTG 381 MD1200 Direct 102087 102165 79 125.1 CUGCGUGUCCAGGCACAGGGCG ACCUGGGCCACGGCGCGCAGCA
99 TCGTCCCCGTCGTAGTAGGCGTCCGCGGCATCGTCGTCGTGCGCGTGGGCGCCGACGCCGGGGTGGCGG 486 MD1204 Direct 102397 102465 69 120.4 CGCGGCAUCGUCGUCGUGCGCG GCGUGGGCGCCGACGCCGGGGU
100 GGCCACGAAGTTGAAGACGGGCAGGCGCTCGTTGAAGATCTCGTGACGCGTGTAGTAGAACTGCGTCTCGGGGCTGGCGCTGGCCACGTCGTCGTCGTGCAGCC 245 MD1208 Direct 102627 102730 104 133.8 CGAAGUUGAAGACGGGCAGGCG UGCGUCUCGGGGCUGGCGCUGG
101 TGACCTGGATGAGGTCGCCGGCCAGGCGGCGGCCCAAGAATAACGGTTCGCGCGTGCACTGCTGCTCGGCCGGCGCCGTCTCGTCGTAGGCCA 278 MD1214 Direct 103316 103408 93 131.5 CAGGCGGCGGCCCAAGAAUAAC UCGGCCGGCGCCGUCUCGUCGU
102 GCCGCGCGTGCTCGCGGAAGGTGTTGATCTGCGCGTCGACGTGCGTGAGCTCCGCCAGGTCGCGGCGGTTGCGCGCCACGGCGTAGGCGACGAACTGCGGCACGCGCTGGC 146 MD1217 Direct 103496 103606 111 141.6 AUCUGCGCGUCGACGUGCGUGA CGGUUGCGCGCCACGGCGUAGG
103 CGCCGCGAGTCCGTGCATTTCTGCGTCTGCAGGCAGAAGTAAACGCGGCGCGAGGCG 329 MD1228 Direct 104068 104124 57 128.6 CGAGUCCGUGCAUUUCUGCGUC AGAAGUAAACGCGGCGCGAGGC
104 TCCTCAAGGGCTACCTCGCGGACGGCTGTCTGCCTCACACGCGGCCCGCGGCCGAGGTGGAGTGTAGGAAGTCGCAGCGCATCCTCGAGGCCCTGGA 445 MD1233 Direct 104500 104596 97 122.1 ACGGCUGUCUGCCUCACACGCG CAGCGCAUCCUCGAGGCCCUGG
105 GTCGCAGCGCATCCTCGAGGCCCTGGACATTTTGATCCTTAAGCTGGTGGTCGGCGAGTTCGTCATGTCCGACACCGAGAGTCTGGAGATGTTGCTGGAC 402 MD1234 Direct 104570 104669 100 124.2 CCUGGACAUUUUGAUCCUUAAG CGAGUUCGUCAUGUCCGACACC
106 GGTGGACATGGACTGCGAGAAGAGCGCCTTCATGCTCGACGCCGCCGCCTCTTCGGAAAACGCGGAGCTCGAGGGGGCCGTGGGCGGCGTCGACGTGCCCTCGACCGCGGTCTCTTCTTCT 117 MD1237 Direct 104723 104843 121 144.9 UCGACGCCGCCGCCUCUUCGGA AGGGGGCCGUGGGCGGCGUCGA
107 GCCTGGAAGTTGTAGCTGAGGTTGACGATGTCCATCTGGGGCATCTGTAGGCCCGGCTCGATTAGCTCGGGC 420 MD1259 Direct 106195 106266 72 123.3 GAUGUCCAUCUGGGGCAUCUGU UCUGUAGGCCCGGCUCGAUUAG
108 CCTCCGTCGTCGGGTGGCGTGAAGAGGTTCTGAAAGTCCGTGTCGCTGGCGAAGCGCACGCAGTAGCGCATGTTGAGCGACTTCTCGGCCAGCATCGGCGGCGGGGG 35 MD1260 Direct 106501 106607 107 162.6 UUCUGAAAGUCCGUGUCGCUGG AGCGCAUGUUGAGCGACUUCUC
109 ACTGGTTGGAGTAGAAATCGAGCCAGAGATATGTGACGTTCATGGTTTTGGGGCCGGCCAGGATGTAGCGCTTGGGGAACTTGGGCATGGGGGCTACGGTCACGTTGTTGAGGATCAGCGGGGCGTAGTCTGTGCTATTGTCCCTCGTCTGTGGTGTTTTGATCGTCTTTACTTTATATCTGCCTCTAGACCGCTTACGTGTTTCAATTTCGAGTTTGAGTTTTAAGATCTCCAGT 133 MD1279 Direct 108144 108379 236 143.0 AAAUCGAGCCAGAGAUAUGUGA CGGGGCGUAGUCUGUGCUAUUG
110 TGGCCGACAGTGCGTAGATGGCCATCATCAGTGCGCGGCTGTCGGTGGCGTCTATGACCACGTCGGTCA 210 MD1287 Direct 109022 109090 69 135.7 CAGUGCGUAGAUGGCCAUCAUC CGGUGGCGUCUAUGACCACGUC
111 GCCGCCACGATGGGTCGCGTGGTGTGCATGTTGCGCGTCAGCTCGCACTCCTCGTGGCTCTCGGTGCGCGT 350 MD1289 Direct 109291 109361 71 126.8 AUGGGUCGCGUGGUGUGCAUGU UCGCACUCCUCGUGGCUCUCGG
112 TCTGGGAACATGCGCGCCAGGCGCTCCAGCGAGTGGTCGCGCCGGCCGCTGCTCGAGCAGGGCGTGTACAGGTCGCTCAGG 343 MD1294 Direct 109585 109665 81 127.8 GAGUGGUCGCGCCGGCCGCUGC GCCGCUGCUCGAGCAGGGCGUG
113 TGTGTCGGGCCAGGATGTAGGCCGCCCGCGTCAGGCTGGGTACCGTGCTCACTGCCCCCACCGCGGTGAAGGCCTTGCGTGCCATCTCCACGGCGCGGGGGTAGGACAGCGTCGTGTTGCCTGACGGGGGGTCGATCTGTCGCCGCAGGCACA 305 MD1299 Direct 109919 110071 153 129.6 UGAAGGCCUUGCGUGCCAUCUC UGUUGCCUGACGGGGGGUCGAU
114 GCGGGGGTAGGACAGCGTCGTGTTGCCTGACGGGGGGTCGATCTGTCGCCGCAGGCACACGGTCATGAAGTCCTGCGCCTGC 227 MD1300 Direct 110013 110094 82 134.7 CAGCGUCGUGUUGCCUGACGGG CAGGCACACGGUCAUGAAGUCC
115 GTCGGGCTCTTTGAGGTAGGGGTGCCGGTGCAGGTGGGACTTCTTGATGAGCACCAGCAGCTCGTGCTTCTGGGTCTGGC 340 MD1305 Direct 110331 110410 80 128.0 UUUGAGGUAGGGGUGCCGGUGC AGCAGCUCGUGCUUCUGGGUCU
116 TCGCGCTGGTAGGGGGCCTTGAAGGCCACGCGTGACAGGTCGCCGAAGAGCAGGAGCGCTGGCGCGTCGTCGATCGTCGCCCGTAGTGCGAAGAAGTCCTCCGTCAGCGTGA 431 MD1307 Direct 110425 110536 112 122.9 CACGCGUGACAGGUCGCCGAAG CGUCGUCGAUCGUCGCCCGUAG
117 TGTAGTGCGCGGCTCCCTCGGGCTGGGGGCACTGTAGCGCCGGACTGTAAGAGAGGAGAGACGTGTCCCGCTCGCCATGTCCTTCTCCTCGGATCCCGGCGCCGGGACTAGCGGCGACGGAGGGGACGCGCTGCA 134 MD1318 Direct 111386 111520 135 142.9 GACUGUAAGAGAGGAGAGACGU UGUCCUUCUCCUCGGAUCCCGG
118 GCCGTGGTGCAGGAGCGGCTCTCGGGCCAGGTGCGCGACGATGTGCTCTCGCTCTGGACCCGCCGCCTGCTCGCGGC 228 MD1333 Direct 113212 113288 77 134.6 GGAGCGGCUCUCGGGCCAGGUG UCGCUCUGGACCCGCCGCCUGC
119 GTGCGCGACGATGTGCTCTCGCTCTGGACCCGCCGCCTGCTCGCGGCCAAGATGGGCCGCGAGGTGCCCGTCTTCGTGCAC 523 MD1336 Direct 113242 113322 81 118.9 UGUGCUCUCGCUCUGGACCCGC CCGCGAGGUGCCCGUCUUCGUG
120 CGCGGCCAAGATGGGCCGCGAGGTGCCCGTCTTCGTGCACGAGCAGCAGTACCTGCGCTCGGGCCTCACGTGCATCACGGGGCTGCTCTTGCTGTG 393 MD1337 Direct 113283 113378 96 124.4 AGCAGCAGUACCUGCGCUCGGG CUCGGGCCUCACGUGCAUCACG
121 TTCACGCTCTCGGACCTGCTGGGCCAAGACGCCGGGGGGCTTCCAGGGGGACGGGCCGGGGGCGAGGA 592 MD1341 Direct 113425 113492 68 116.2 AAGACGCCGGGGGGCUUCCAGG CAGGGGGACGGGCCGGGGGCGA
122 CGAACTCCTCTACTTTCTGGTGCTGGGGTTTCTTCCGAGCGTGGCGGTGGTGTAAGCGCCGTCACGTGTCGCCCGCAGCATAAAGGGCGTTCG 315 MD1345 Direct 113940 114032 93 129.2 GGGUUUCUUCCGAGCGUGGCGG CCGUCACGUGUCGCCCGCAGCA
123 AGAGAAGAGGGTCTCGGCGTCGACACGGAGGAGGCAGACAGACGGCAGGCGGCCGGCCGGGCACCGGCTGCAACCCTCTCCTCTTCTGCCTGGTACCGATGACCGTCGCGCTCT 360 MD1346 Direct 114048 114161 114 126.6 AGGCAGACAGACGGCAGGCGGC GGCUGCAACCCUCUCCUCUUCU
124 GCGCGACGCCGCCTGGCCCTACGTGGGTCGCGTCTGCAGTTACTACGTGACCTGTCTGCTGCTCTACGTGCCCCACTACTGCTTCAGGGTGTTGCGT 377 MD1356 Direct 114796 114892 97 125.3 UACGUGGGUCGCGUCUGCAGUU UGCUGCUCUACGUGCCCCACUA
125 GCTGCGCCTTAGCGTGCTGCCGCTGTTCATCGTGGCGCTCTTCTCGAGCAACCCTACCCAGGACCTGGACGTGTCCCTCGAGCGGCTGCTGGAGAGCTGCTCGCGCAGCGGCGGCTGCTGCGGCGTCAGT 339 MD1358 Direct 114967 115096 130 128.0 CGCCUUAGCGUGCUGCCGCUGU CAGCGGCGGCUGCUGCGGCGUC
126 GTGAGGCCAGTACGGTTGGGGCGTCTTGCGGCTCAGTACGGCGTTGTCCGAGACGCCCAGGTTGTTCATGGTCTCGC 235 MD1371 Direct 116047 116123 77 134.3 AGUACGGUUGGGGCGUCUUGCG UCCGAGACGCCCAGGUUGUUCA
127 CGAGGCCGAGCTGCTGCTGCCGCGCGACGTGGTGGAACGTTGGTTGGGTAGCGGCGGCGATGGCACG 488 MD1378 Direct 116483 116549 67 120.3 CCGAGCUGCUGCUGCCGCGCGA UUGGUUGGGUAGCGGCGGCGAU
128 CTGCTGCTGCCGCGCGACGTGGTGGAACGTTGGTTGGGTAGCGGCGGCGATGGCACGCCGATGCCTCTCAACGTCAACCACGACGACGCGGCCGTGGTGG 19 MD1379 Direct 116493 116592 100 170.1 UGGAACGUUGGUUGGGUAGCGG CGAUGCCUCUCAACGUCAACCA
129 TGCCTGGGTTGCGTCACCTCGCCGCGCTTTCTGGAGATCGTCAGCCGCGCCTCCGAAAAGTCCGAGCTGGTCTCGCGCGGCCCTCCCTGCA 446 MD1381 Direct 116634 116724 91 122.1 UCACCUCGCCGCGCUUUCUGGA CGCGCCUCCGAAAAGUCCGAGC
130 GGCGGTGGAGATGTCGCACCCGCTGACGGCCGCGGCGGCTCCCGGCGCCGCCGCCATCCCGCCACCGCCGTCGTCGGCCGTGGTGCCGGCTCCCCTCACGCTGCC 299 MD1394 Direct 117326 117430 105 130.0 AUGUCGCACCCGCUGACGGCCG CCGCCACCGCCGUCGUCGGCCG
131 ACCGGCGACGCCACCCCACCGCCGCAGACGACGCCCGCCGGCAAAGTCGGGGCCGCCGAGCGCGCGGCCGCCGCCGTCGCCGGGGTGGTCAATGCCTCGTGTCGGGTGGATCACGCGGT 308 MD1406 Direct 118272 118390 119 129.5 GGGCCGCCGAGCGCGCGGCCGC GGCCGCCGCCGUCGCCGGGGUG
132 AGGGCCAGCGCCCGAGACAGTCCCTCCTCGGTGTCCGACTCCTCCTCCTCTGAGCTCTCCTCGAAGGCGGCGAACACGGATTCGGATAGGGCGGGCGGCGTCGGGGTGCTGGAGCGCTCCT 233 MD1418 Direct 119072 119192 121 134.3 UCCUCUGAGCUCUCCUCGAAGG AUUCGGAUAGGGCGGGCGGCGU
133 TCACGTCGTGGGTGTTGTTGGTCTCGAAGGCGTTCTGCACCTGCACGATGTACTCGCGATGGAGGCGCGACAGTGTGA 587 MD1428 Direct 119517 119594 78 116.4 GUUCUGCACCUGCACGAUGUAC CGAUGUACUCGCGAUGGAGGCG
134 GGTGTTGTTGGTCTCGAAGGCGTTCTGCACCTGCACGATGTACTCGCGATGGAGGCGCGACAGTGTGAAGCCGCGCGGGGCGTGCAGGGTGAAGCCGTTGTCGCCATGCC 251 MD1429 Direct 119527 119636 110 133.4 UCGAAGGCGUUCUGCACCUGCA CGCGGGGCGUGCAGGGUGAAGC
135 CGTTTACCCACTGGCCGCGGGCGTCCGTCTCCGCTTTGTGGATGTAGGTGTTGCGGTCCGAGCACGACAGCAGCTCCACGGCGTCCACCAGCCTCAGCGGGATGGCCCCGGCCCGGAAGATG 225 MD1435 Direct 119751 119872 122 134.8 UCCGCUUUGUGGAUGUAGGUGU CAGCAGCUCCACGGCGUCCACC
136 GATGGGCGTCGACGAGCCGGGCGACATGCGCCGCTGGCTGTAGTTGATCAGGTCGGCCTTGAGCTGGTCGCGCTCGCCCACCGCGCAGTGCCCCTTGACGTTCAGGTCCGTC 264 MD1442 Direct 120097 120208 112 132.7 CGCUGGCUGUAGUUGAUCAGGU GGUCGCGCUCGCCCACCGCGCA
137 TTGAGGTTGTGGCCCTGGACCGTGGCCACCAGGGGCACCAGGTGGCGCGCCTGGATGCCGGCCTGCCACTGGGGCCAGGTGAACACGGCCGGGTTGCTGCTGTCGA 82 MD1452 Direct 120833 120938 106 150.1 UGGAUGCCGGCCUGCCACUGGG CCUGCCACUGGGGCCAGGUGAA
138 CACGGCCGGGTTGCTGCTGTCGATGTCCGAGTCCTCGTCGGTATCCTCCTCGGGTGCCATGCTGGACTCGGCCTTGAGGCGGCCGCGCGTCATCACGCCCGTG 462 MD1453 Direct 120916 121018 103 121.6 GAUGUCCGAGUCCUCGUCGGUA UGCCAUGCUGGACUCGGCCUUG
139 GCGGCGGCGGCTCCGGCGAGGGGCAGGGGGCGGGGCGGTTTGCGGTCCGCCAGCTCGTCCTCGTCGGAGTCGGAGCCGCTGC 159 MD1455 Direct 121058 121139 82 140.3 UCCGGCGAGGGGCAGGGGGCGG CGCCAGCUCGUCCUCGUCGGAG
140 GCGGCGGCTCCGGCGAGGGGCAGGGGGCGGGGCGGTTTGCGGTCCGCCAGCTCGTCCTCGTCGGAGTCGGAGCCGCTGC 250 MD1456 Direct 121061 121139 79 133.4 UCCGGCGAGGGGCAGGGGGCGG UCCUCGUCGGAGUCGGAGCCGC
141 TTGCCCGGCTTGATGACCAGGCTCTTGGGGGCCATGATGGTGAAGCCGTTGCGCTGGTGCTTGCGCATGAAGGGCTGCGGGTTGCGCGTCATGGTTAGGTCCTCCTCCTCGTCGGAGCCCAGCGA 296 MD1459 Direct 121484 121608 125 130.3 AUGACCAGGCUCUUGGGGGCCA AAGGGCUGCGGGUUGCGCGUCA
142 TGCTGCCGCGCCCACGATAGGTTAGACACGGTCAGGCGCGCCTGCCACACCTGCTTGCCCGACTGGTGGATGATGGTGTCGGCCACGGGCAGGTGGCGGTACTTGCGCTCGGCCGTGGTGGGGTAGTGGTGCA 153 MD1466 Direct 121826 121958 133 141.1 AGACACGGUCAGGCGCGCCUGC CACGGGCAGGUGGCGGUACUUG
143 GGGTCGACTCGGGCGTGTACTGCGAGATCAGGATCAGTGAGTGCTGGCTGACCTTCACGTCGATGCCCGTCTGCAGCGACTT 234 MD1473 Direct 122142 122223 82 134.3 AUCAGUGAGUGCUGGCUGACCU UGACCUUCACGUCGAUGCCCGU
144 GAGAGACAGTGACTTGTAGTGTTTTGTGGGTTGTTGCGGCGGCGTCCCTAGAGGTCGCCGCAGATCATGGCTAGCGTCACGGGGCTCGGTTTCTC 187 MD1479 Direct 122625 122719 95 137.5 CGGCGUCCCUAGAGGUCGCCGC CGCCGCAGAUCAUGGCUAGCGU
145 GGCTCGGCGCTCAACAGCCGCATGGGCAGCAGGTCCTGGAGCGCGATCGAGGCGCCCAGCACCGACAGCTGCGGGGCCGGTCGGTTGTGCAGCGCCGACT 105 MD1482 Direct 122751 122850 100 146.7 GCAUGGGCAGCAGGUCCUGGAG GCCCAGCACCGACAGCUGCGGG
146 TCGCAGGCGGAACGACACCGGGTCGCTGGGACCCTCGCTGCGGTCGCACGTCACGTTGAAACGCAGGACGCAGTCCTGGTACAGCGTGAGCGACGACAGCGTCAGGTCCGCGGGCGACTCGGCGTCCAGTTCCAGCCGTCCGA 31 MD1492 Direct 123317 123459 143 165.1 GGAACGACACCGGGUCGCUGGG GUACAGCGUGAGCGACGACAGC
147 GGTAGTTGTCGATCACCGGGTCGGGCAGCGTGAAGGTGGCGTCGCGGTAGGTGATGGTCTTTAGCTGGTGCACGGCCGCCTTTACCTCCTCGTACGAGCGGTCGAGCGAGAACAGGCC 32 MD1510 Direct 124763 124880 118 164.2 GUGAAGGUGGCGUCGCGGUAGG GCUGGUGCACGGCCGCCUUUAC
148 TGCCTAGCGTCAGCAGATTTTCGCGCGCCATGGGTCCGTTGAAGAGCGGCGGCAGCAGGCA 461 MD1511 Direct 124955 125015 61 121.6 UUCGCGCGCCAUGGGUCCGUUG UUGAAGAGCGGCGGCAGCAGGC
149 CCGCCGTCAGCTTGGCCAGTTTGCCCAGGTCGGCGATGGTCAGCTTGTGGTCGAAGGTGCAGAAGATGGTGG 190 MD1519 Direct 125252 125323 72 137.2 AGCUUGGCCAGUUUGCCCAGGU UUGUGGUCGAAGGUGCAGAAGA
150 GCTCCGTCAGGCGAGCCGCGTCGTTCGCGGACGCGGCGGTGGGTCCGGCCACAGAGCGACACGCGGCCCACGCTGTTCGTCCGCGCTCGTCGCAGTCCGCGCTTCACGAGT 16 MD1523 Direct 125412 125522 111 172.6 UUCGCGGACGCGGCGGUGGGUC CCACGCUGUUCGUCCGCGCUCG
151 CGTGGTGCTGAGGATCGGCAGCGCTTCCTGCGTCAGACGGCACGGGTTTTCGATCAGTTGTTCCGTGCCCTCGACGCAGATGTACTGCGTGTCCGTGTCGCCGCG 276 MD1524 Direct 125644 125748 105 131.6 UCCUGCGUCAGACGGCACGGGU UUCCGUGCCCUCGACGCAGAUG
152 CCCGCTGCCGCTGCCCGACGTGGCGGTGCCCGACGACGCCGCCGCGGTGCCCGTCGCGCTGGCCGTCGCCGTCGTCGACGCGGCCTGTCGGTCAGCCGCCAGCAGG 4 MD1544 Direct 127120 127225 106 188.3 CCGACGACGCCGCCGCGGUGCC UGGCCGUCGCCGUCGUCGACGC
153 GGCTGCCGGTCGGCCACGATCTGCACGCCCTCCGTGGTGCGCGGCAGGTGCGTGATGAAGGGCGGCC 611 MD1550 Direct 127463 127529 67 115.4 CACGAUCUGCACGCCCUCCGUG GCGGCAGGUGCGUGAUGAAGGG
154 CCGTGCGCGGCACCTCGCGCCGCACGCGGTAGAAGTGGCCGACGCGCCGCGCGATGCCGCCCATGG 472 MD1561 Direct 128151 128216 66 121.2 CGCGGCACCUCGCGCCGCACGC ACGCGCCGCGCGAUGCCGCCCA
155 GGCGTGAGGCTGTGCGCGCCGGCCTGCGACAGCGAGTCGCTGGGCAGGTGCGGCTGGCCCGACGTC 432 MD1569 Direct 128615 128680 66 122.7 UGAGGCUGUGCGCGCCGGCCUG UGGGCAGGUGCGGCUGGCCCGA
156 GACGTCAGGTGGCCCTTGTAGGAGTTGAAGTCGGCCAGGATGGAGTGGTAGGCGATGGCCGTCACGGCGTTCTCGGGGCTGAGCACGAAGTTGCCGTAGGTGGCCGGCGCCGACACCGTCTCCTTGCTGATGAGGCCCGAGAGCAGCGACATGATGATC 43 MD1570 Direct 128675 128833 159 159.1 UAGGAGUUGAAGUCGGCCAGGA AGUUGCCGUAGGUGGCCGGCGC
157 GCAGCGTCTGCAAGAAGCTGTGGATCAGGCCGCGCTCCATGGCGTCGGCCGTGTTCTTGAGCGCGCGCAGCACCGTGTGCATGGCCTCCACGTTGAGGATCTTGTCCAGGATGGTGC 310 MD1579 Direct 129126 129242 117 129.4 CUGCAAGAAGCUGUGGAUCAGG CGCAGCACCGUGUGCAUGGCCU
158 GCCGTGTTCTTGAGCGCGCGCAGCACCGTGTGCATGGCCTCCACGTTGAGGATCTTGTCCAGGATGGTGCCCTCGAAGGTCTCGCGCAGGTACGTCAGGCAGGCGGCGCTCAGCTCGAAGGGGATGGTGATGGGCGACTTCTCGCTGTATTTGGTGACCATGATGGTGGTCTGGCGCGTGGTGGGCAGTCCGGC 383 MD1580 Direct 129173 129366 194 125.1 CGCAGCACCGUGUGCAUGGCCU ACCAUGAUGGUGGUCUGGCGCG
159 GCATCTTGCCCGTGGTCAGCTTGTTGAGGTCGTGGAACTTGATGGCGTGCGCCGCCGCCGCCAGCCCGCTGGTCAGGAAGTAGACCCACTCCAGGCGGTTGCAGAAGGTGC 590 MD1585 Direct 129402 129503 102 116.3 UGCGCCGCCGCCGCCAGCCCGC CAGCCCGCUGGUCAGGAAGUAG
160 CCGCGCCTGTCCCGCGCACGTGCGCGCCGAGGCCGACCGCGTCAAGTTGGTGCTGGGCCGCCTGCTGCTGGGGCCCGTGG 346 MD1592 Direct 129903 129982 80 127.2 CGCGCACGUGCGCGCCGAGGCC UGCUGGGCCGCCUGCUGCUGGG
161 GTCCCGTCTCCTGGGCGGCGGCGGCGGGCCTCTGGACGCGGTGGCGGCGACCGCGGCTCGCGCGGGCTCCGGACGGCGGGGCGGCGCGGCTGCCGGGAAGGGAC 357 MD1610 Direct 131166 131269 104 126.7 CUCUGGACGCGGUGGCGGCGAC GCUCGCGCGGGCUCCGGACGGC
162 CTGCCGGGAAGGGACAGCGCGACCCCTCGGCCGATCGCATCCGCCGCTACGTCTGCATCATCTCGCGTCTCATGTTCGCCCGCTACGGCGAGAGGGGCCGGCGCCAGAGACAGCGTCGCGACGGCGATGCCGACGGGAGCGGCGCTTTTGATTTCACCGGCCAG 219 MD1612 Direct 131255 131418 164 135.3 CGACCCCUCGGCCGAUCGCAUC CGAGAGGGGCCGGCGCCAGAGA
163 GGTCATCCGGCAGACGCTGTTTCGCCTGTGCGGCGACGCCGCTGGTAGCGGTGGTGGGCTGTTCGGCGCGTCCGGTCAGCCGTCTTCGGAGACC 99 MD1623 Direct 132531 132624 94 147.5 CUGGUAGCGGUGGUGGGCUGUU UGGUGGGCUGUUCGGCGCGUCC
164 CCAGAAGATGATGGAAGCGGCGGCGTCGGCGTCCGCAACGGCTTCCAGACTCGGCGGCGGCGCCACCGGCGGTTCTGCTTCCTCGTCTTTCTTGG 236 MD1624 Direct 132716 132810 95 134.3 CGGCGGCGUCGGCGUCCGCAAC CGGCGGCGCCACCGGCGGUUCU
165 CCGAAGACCAGTGTGCTCTGGGCGCCGGACGTGGAGATCAGCACGGTCCGCCGGCACAGCGCGGCGGTCCGCGCTTTCGCGTCGGCTCTCAGGAACTACATGTTTTGG 158 MD1634 Direct 133464 133571 108 140.4 CAGUGUGCUCUGGGCGCCGGAC CGGUCCGCGCUUUCGCGUCGGC
166 TGAGGCAGGCGATGCGCACGGCCGCCGCCTGGTTGCTGTTGCCCTCCACGGCGATGCGCAGCTCGTCCAGGTAGGGGTGCAGGCTGAGGATGGAGACGGCCATGTGCGCCGCGCACTCG 71 MD1650 Direct 134644 134762 119 152.3 CGAUGCGCACGGCCGCCGCCUG CCAGGUAGGGGUGCAGGCUGAG
167 GCGCAGGATGTCGAACTCCTCGCGGCTCTGGTCCGTGATGAGCACGTTGTTCTGCGC 580 MD1655 Direct 134963 135019 57 116.5 CUCGCGGCUCUGGUCCGUGAUG GUGAUGAGCACGUUGUUCUGCG
168 GCGCGCCGTCTCCGCGGCGGTTATCGCCCGCGGGCGCCAAACCGTGCCGAGGCGGGCGGGAACCAATCACCCGGCGCGATTTGGCGCCCGCGGGAACCGTCGGTCCGC 80 MD1661 Direct 135495 135602 108 150.5 GGGCGCCAAACCGUGCCGAGGC ACCCGGCGCGAUUUGGCGCCCG
169 CGCCTCTTTCACAATTTCGCCTTTCTCTTCCAGACCGAGGAGTCCAGCCCCCGTCGCCTGGAATTGGTCTCCGGCCTCTTTGAGCACCTGACGGTGGAATGCGTCAATGACATCGTGGACGCGTGCAACCACCCGGACGTTCCCGGGACCGAAGGCGGTGGCGGCAGTGGCGCTGCGGGAGGAGGAGCAGCGGCGGAGGGAGGCG 471 MD1664 Direct 135757 135961 205 121.3 CCUUUCUCUUCCAGACCGAGGA CGGACGUUCCCGGGACCGAAGG
170 CGGCCGCGGGATGTGCGACGCCTCGGGCGCCTGCGACATGAGGCACGTCCACAACGCCTTCACCGAGGAGATCCAGCTGCACTCGCTGTACGCCTGCACGCGGTGCTTCCGCACGCACCTGTGCGACCTGGGCAGCGGCTGCGCGCTCATCTCCACGCTGGAGGGCTCGGTGTGCGTCAAGACGGGACTGGTGTACGAGGCGCTCTACCCCGTGGCGCG 116 MD1666 Direct 136070 136288 219 144.9 CUCGCUGUACGCCUGCACGCGG UACGAGGCGCUCUACCCCGUGG
171 GCGGCGTCTACAGCTACCTCATGACGCACGCCGGCCGCTACGCCGACGTGATTCAGGAGGTGGTGGAGCGCGACCGC 344 MD1672 Direct 136360 136436 77 127.8 AGCUACCUCAUGACGCACGCCG ACGUGAUUCAGGAGGUGGUGGA
172 GCGCGAGGACGCGCTGCTCAAGCAGATGCGTTCCGAGTATGGAAACGCACCTGTATTCGGATCTGGCCTTTGAGGCGCGCTTCGCCGC 110 MD1676 Direct 136616 136703 88 146.0 UCAAGCAGAUGCGUUCCGAGUA UUCGGAUCUGGCCUUUGAGGCG
173 GCGACCTGGAGCTGCGGGTGGCGCGGCTGCTGCGCGGCGACCCCGAGTTCACCTATCACGCGGGCCCGCTGGAGCCGCCCTCCCGCATCCGCGGACGC 206 MD1684 Direct 137426 137523 98 136.1 UGCGGGUGGCGCGGCUGCUGCG GGGCCCGCUGGAGCCGCCCUCC
174 GCGCGCAGGTCGATCTCGGCGTCGAGGTGCGCGTGCGTCGCTGCCGGCGCACGGGGCTGTGGGTCGCCCGCGACCGCCGCGGACAGCTGAGGCGCTGGCCCTCCCAGGCCGAGGTCTGCGTGC 209 MD1695 Direct 138134 138256 123 135.8 GUCGCUGCCGGCGCACGGGGCU CGCGACCGCCGCGGACAGCUGA
175 GGAGACGGGGCGGTGAGCCTCACCGGCGACAAGGCCGTGAGCCTGGGCGGCACGGGCGCCTGGCTGGTGGTGCGTCCGGAGGGTTACGTGCTCTATTTCT 162 MD1710 Direct 138803 138902 100 140.3 UGGGCGGCACGGGCGCCUGGCU UGGCUGGUGGUGCGUCCGGAGG
176 GGGGTTGGTTGCAGGCCAAGCAGGACGTGTGGGATCTGGTGAAGGTGGAGGAGCCGGTGTCGCGCATGTTGGTCTGCTCCTGCCCC 429 MD1714 Direct 139263 139348 86 123.0 AGGACGUGUGGGAUCUGGUGAA UGUCGCGCAUGUUGGUCUGCUC
177 GCAGGCCAAGCAGGACGTGTGGGATCTGGTGAAGGTGGAGGAGCCGGTGTCGCGCATGTTGGTCTGCTCCTGC 417 MD1715 Direct 139273 139345 73 123.4 CAAGCAGGACGUGUGGGAUCUG UGUCGCGCAUGUUGGUCUGCUC
178 CTTTTGAAACGGCTCGAGTCGGATGGGTTTGGCGTCGCCCTCGGCGGTGGCGAAGCCGCCGTCGAGCCACTTCTTGAAG 303 MD1724 Direct 139903 139981 79 129.8 CUCGAGUCGGAUGGGUUUGGCG GCGAAGCCGCCGUCGAGCCACU
179 GTTGGTGAAGGCCGTGGAGATGCAGGAGGTGGGGTGGTTCTTGCGCTTCTGCAGCTCTTCATAGCGCTCCTGGATCTTGGCGGCCGAGTCGCCGTGC 404 MD1727 Direct 140275 140371 97 124.1 GGCCGUGGAGAUGCAGGAGGUG UCUUCAUAGCGCUCCUGGAUCU
180 CGGTCGAGGCGCCCGCCTCCGTGCCGGGCGATGACGACGAAGAAGGAGGAGGGGGGGAGGATAACTCTTCTTCCTCGCGCTTCTCGGCCTTCCGTCACGACGTGCTGGAGCGCTTCGCGGTCTCGGCCG 92 MD1738 Direct 140889 141017 129 148.4 ACGAAGAAGGAGGAGGGGGGGA CCUCGCGCUUCUCGGCCUUCCG
181 CAGAGAGGTGCTGCAGGTGGTGCGAAGCCGCTTCTCCGGGCGCGAGGTGCCCACCTGGCCCGCCTCGTCCCGGACCTGCCTGCTCTGCGCCCTCTACAGCCAGAACCGCCTCTG 87 MD1748 Direct 141595 141708 114 149.5 AGAGGUGCUGCAGGUGGUGCGA CCUCGUCCCGGACCUGCCUGCU
182 CGCCATGGCCTCGTCGCTGCGCTCGCGGGCCCGCTCCTCCTCGGCCGACTCGGGCTCGGGCTGGGACCCGCCGCCGCTGCAGCGGCCCAGCCGCGCGCG 598 MD1758 Direct 142367 142465 99 115.9 UGCGCUCGCGGGCCCGCUCCUC UCGGGCUGGGACCCGCCGCCGC
183 GCCGGCGACGTCGGCGTTGCAGCAGCGGCGGTCAGGGTCAGCGGGGGCCCCTGGTCTCCCTGGCCCGCACCCCTCTCTGTCGCACCGGCGGTCGCGCCGTCCGC 101 MD1768 Direct 143059 143162 104 147.4 CGGGGGCCCCUGGUCUCCCUGG UCCCUGGCCCGCACCCCUCUCU
184 GCCTCGACCACCCCGAGCTCTGCGAGGTCTCGCTCTCGTACCTCCTGGTCTACGTGCCCAAGGACGAGGACTTCTGCCAGAAGGTTTGCTACGCCGTGGACCTGAGCGACGAGAGCTTTCGCCTGGGCCAGGGCTCCTTCGGCGAGGT 365 MD1774 Direct 143446 143593 148 126.4 UCUGCGAGGUCUCGCUCUCGUA GGCCAGGGCUCCUUCGGCGAGG
185 CCCACACGCGCGCTTCCCCGTCTCCGGTCTGCGGCGCTTCTGCATGGCCGAGCTGGCGGCGCTGGGCAACGTGCTGGGCTTCTGCCTCATGCGGCTGCTGGACCGCCGCGGCCTGGACGAGGTGCGCCTGGG 372 MD1785 Direct 144164 144295 132 125.5 CGCGCGCUUCCCCGUCUCCGGU CGGCCUGGACGAGGUGCGCCUG
186 CGCAACCTGCCCTTCACGGTCCTGCGCCTGTCGTACGCCTACCGCATCTTCGCCAAGATGCTGCGGGCCCACGGCATGCCGGTGGCCGAGGAGTTCATGTCGCG 29 MD1794 Direct 144985 145088 104 166.7 CGCAUCUUCGCCAAGAUGCUGC CGGCAUGCCGGUGGCCGAGGAG
187 GCTGCGGGCCCACGGCATGCCGGTGGCCGAGGAGTTCATGTCGCGCGTCGCCGCGCTGGCTCGCGACGAAGGGCTGCGCGACATCCTGAGCCAGCGGCATGCCACCGAGGCCTCGCGC 410 MD1795 Direct 145044 145161 118 123.9 GCCCACGGCAUGCCGGUGGCCG CGACAUCCUGAGCCAGCGGCAU
188 GCTCGCGCGCCGGCGTCTCGCCGGGCATCCAGTTCGGCCTGAAGCACGAGGGCCTGGTTAAGACGCTGGTCGAGT 599 MD1805 Direct 145433 145507 75 115.8 GGCCUGAAGCACGAGGGCCUGG AGGGCCUGGUUAAGACGCUGGU
189 GGCCTCGCTGCTGCAGTCGCACCCGGTGCCGGGCGTGGAGTTCCGCGCCGAGCGCGAGGTGCCCTCGGCCCGCGAGTTCC 610 MD1809 Direct 145752 145831 80 115.5 UGCAGUCGCACCCGGUGCCGGG GAGCGCGAGGUGCCCUCGGCCC
190 GCGCCACCTGCACCAGGTTGACGATCATCGTGCGGAACTGCACGGTGCCGTGCAGCCGGGGGTGCAGGCGC 456 MD1833 Direct 147944 148014 71 121.7 CGUGCGGAACUGCACGGUGCCG CACGGUGCCGUGCAGCCGGGGG
191 GGTGCCGTGCAGCCGGGGGTGCAGGCGCGAGAAGTGGAACAGCGTGCGCTTGTAGCTCTGGTAGTGCGTCACC 221 MD1834 Direct 147987 148059 73 135.2 AGCCGGGGGUGCAGGCGCGAGA UGCGCUUGUAGCUCUGGUAGUG
192 GACCCCAGCGGCGTGGAGATTCTCGAGGCCGTGCCCGCGCTGGGCTTCGACGCGGCCGCGCTCTCGCACGCCCTCAGCCTCTACCACGTCGCCAAGCTGGTGGTC 484 MD1846 Direct 149173 149277 105 120.6 UCGAGGCCGUGCCCGCGCUGGG CGCGCUCUCGCACGCCCUCAGC
193 CCACGTCGCCAAGCTGGTGGTCATCGGCTCCTACCCGGAGATCCACGACGCCGTGGCCACCTCGTCGTCCGTCTCGGCGCGCGTCGCCACCGGCGGCCACGAGG 544 MD1847 Direct 149256 149359 104 118.0 UACCCGGAGAUCCACGACGCCG GCGUCGCCACCGGCGGCCACGA
194 CGTGGCCATGTCGTTCCGCGTCGGCGCCCACAAGTACGTGCTGGAGCGCGACGACGCGGCCGCCGTGGTCTCACG 465 MD1849 Direct 149412 149486 75 121.5 AUGUCGUUCCGCGUCGGCGCCC UGGAGCGCGACGACGCGGCCGC
195 GTGGCCATGTCGTTCCGCGTCGGCGCCCACAAGTACGTGCTGGAGCGCGACGACGCGGCCGC 607 MD1850 Direct 149413 149474 62 115.6 CAUGUCGUUCCGCGUCGGCGCC UGCUGGAGCGCGACGACGCGGC
196 GTGGCAGGTCTTCTGCGGCGAGGGCGGCCGCGCGGTACGCCTCAACGCCACGGCGTTCCGCGAACGGCCGGCCGTGACCGACCTGCTGC 74 MD1855 Direct 149895 149983 89 151.7 AGGGCGGCCGCGCGGUACGCCU UCCGCGAACGGCCGGCCGUGAC
197 GCACGGGCGGCGCGCACCCGCCGCACGACGACGCCACCTTCACCGTGCACGTGCGCGACGCCACGCTGCACCGGGTGGTCATCGTCGACCTGGTCGAGTGCGTGCTGGCCAAGTGC 37 MD1859 Direct 150137 150252 116 162.0 CGCCACCUUCACCGUGCACGUG CACGCUGCACCGGGUGGUCAUC
198 AGGAGCGGGAGCCGTGGGGTCCGGCGGTGGTGGTGCGGGTGGTGGCGGCGGCGGCGGCGCGGCTCCTCCTCCT 542 MD1867 Direct 150678 150750 73 118.1 GAGCCGUGGGGUCCGGCGGUGG GCGGCGGCGGCGCGGCUCCUCC
199 GGTGGCGGCGGCGGCGGCGCGGCTCCTCCTCCTCACTATCACGTCCCCGTGGGCTGTTGCGGCGGCTGCTGCGCAGGCGGGGGCGTGCGCGACGAAGGCGGCTCTCCGGCGGCGGCGCCGCT 351 MD1869 Direct 150718 150839 122 126.8 UGCGGCGGCUGCUGCGCAGGCG UGCGCAGGCGGGGGCGUGCGCG
200 AGCGGCTCGGTGCTCGGCACGTACTGCGAGAAGAAGCTGTTGGCCACCAGCCGGTTGTCCTCCACGGGCAGCGCGCGGAACGGCGTCGCCTCCTGCGCCTTGCGCACCGCCTCGGTCACCGGCAGGTGGTACAGCTCGGCGTCGCGCGCCCCCAGATTCACCGAGTCCT 103 MD1890 Direct 152847 153015 169 147.3 AAGAAGCUGUUGGCCACCAGCC CUUGCGCACCGCCUCGGUCACC
201 GGCGGCACGGCGTCCGGGGCCGACGCGGGAAGAGTAGGCAAGAGCGAACCCTCTACTTCTTCTGTCCCTCGCCCGACCTCTGTCGCGTCCTCGGTCGCCGCTGCCGCC 246 MD1909 Direct 154452 154559 108 133.8 AGCGAACCCUCUACUUCUUCUG CGUCCUCGGUCGCCGCUGCCGC
202 TCGCTGGACGATGTCTCCGAGTTGTGCGAGAGCAACATCATCGTCATCGACGAGTGCGGCCTCATGCTGCGCTACATGCTGCAGGTGGTGGTGTTCTTTTACTACTTTTACAACGCCCTGTGCGA 60 MD1916 Direct 154974 155098 125 154.8 UGCGGCCUCAUGCUGCGCUACA CGCUACAUGCUGCAGGUGGUGG
203 GCAGCAGGAGGTGGCGACCGCTGTTCTCGGCGGCGGTGGTAGCAGAAGCGCCGTGCTGGGTGGCGGCGGAGGTCTGGACGATGTCATCGCCGCCGAGGGAGGCTACGTGCCGCCCGCCGCTGC 353 MD1924 Direct 155762 155884 123 126.8 GGCGGCGGUGGUAGCAGAAGCG AUCGCCGCCGAGGGAGGCUACG
204 CGGCGGCGGTGGTAGCAGAAGCGCCGTGCTGGGTGGCGGCGGAGGTCTGGACGATGTCATCGCCGCCGAGGGAGGCTACGTGCCGCCCGCCGCTGCCG 575 MD1925 Direct 155789 155886 98 116.6 CGCCGUGCUGGGUGGCGGCGGA CAUCGCCGCCGAGGGAGGCUAC
205 GCACGGTGTCGCGCTTCGTGGAGATCCTGCAGAAGGACACCTTCATCGAGCGCACGCCCTGC 549 MD1927 Direct 156007 156068 62 117.7 CGCGCUUCGUGGAGAUCCUGCA CACCUUCAUCGAGCGCACGCCC
206 GGCTCCTTCGTGGGCATGCTCTCGTACGTCTCGCCCGTGCAGACCTACACGCTCGAAGGCTACACCTGTGACAACGTGCTCAGCCTGCCCAGCGACCGCC 591 MD1934 Direct 156639 156738 100 116.3 UACGUCUCGCCCGUGCAGACCU AAGGCUACACCUGUGACAACGU
207 GCGATGGAACTTTCTTCGGTACGGGTTCTTGTTATGGAAGCTTGTGTTTTCGAACATTATGATTCTTTTTTTAGGTAGGCGAAGAAGGGCCTATCGT 556 MD1950 Direct 158247 158343 97 117.5 UGGAAGCUUGUGUUUUCGAACA UUCGAACAUUAUGAUUCUUUUU
208 ACGGACCGGCCGTGAGGCGCTGCGCGGAGGCGCGAGCGTAACGGTTGCTTCTCCTCATCGTCGTCATCGGCCTCCTCCGT 510 MD1977 Direct 159981 160060 80 119.3 CGCGAGCGUAACGGUUGCUUCU GUUGCUUCUCCUCAUCGUCGUC
209 GTCGTCGTCGTACTCGTCGTCGCTGCCGCCTCCCCGGGGTCATCGTTGTGGTTGTCGTCGTTATCGTCGTCGTCCTCCTCTTCCTCGTCGTCGTGGCTCTCTGCGGCTCGCGTTCGCGTTCCCCGGTGACGAAACCCGCGCACACCGCAGAACGCCGAAGGCGCGACGGCACGGCAGAGGATGATGTGGGAGGAGAGGCGAGGAGACGGACACAGCAGACCGCGGCGGGAGGAGGGGGCGGCAGCCTCCTCGTACGCGGAGAC 201 MD1987 Direct 160450 160712 263 136.4 CGUCCUCCUCUUCCUCGUCGUC CGCGGCGGGAGGAGGGGGCGGC
210 GATACTAGTGGTGGTCGTGGTTTCTTTTTTGGGTTGTTTGGATGCTCGATTATATCCTGTTTATGGGGTTCTTATCATCATCTACTCGGTCGTAGAAGGACCTACTACGACCCTATAGCTATC 204 MD1990 Direct 160726 160848 123 136.1 GUGGUCGUGGUUUCUUUUUUGG CCUACUACGACCCUAUAGCUAU
211 TTTTCTTCTTGCCATGATTTCGTCCACCCTTTTTTCGACGATTACTACAAAAATCTCTGAAGAAGAGAGAGGATAGATCGCGGCGGGGGAGAAGA 104 MD2008 Direct 162135 162229 95 147.0 UCGUCCACCCUUUUUUCGACGA UCUGAAGAAGAGAGAGGAUAGA
212 GGGTGCGGCGGCAGCGGCAACGAAAGAGGCGAGGAGGAGTCTCGGCCGCGGACGCCGAAGATGGCGGTCGCCGGGCCTTCTCCTCGTCCTCTTCGGGCCGAGCCGGTCCC 68 MD2039 Direct 164082 164191 110 153.0 CGAAAGAGGCGAGGAGGAGUCU UCGCCGGGCCUUCUCCUCGUCC
213 CTGGTGTTCTTGGGCGAGGGGTGGCAGGCCTTGAGCACCAGGTGGCGTCGACGGTCAATCAGGTACTCGCAGCTCTGCGCCTCGGCGCCCCACAGCATGAACACCAG 450 MD2053 Direct 165600 165706 107 122.0 UGGCAGGCCUUGAGCACCAGGU CAGGUACUCGCAGCUCUGCGCC
214 TCTCGCGCAGCAGCGCCGTGTCGTGCTCGGGCAGGCTGAGGAAGCGCACCCAGTCGGCGCTCAGACAAAACACGCGAGCCTGCTCGTCGGGG 509 MD2059 Direct 166108 166199 92 119.4 CGCCGUGUCGUGCUCGGGCAGG AAACACGCGAGCCUGCUCGUCG
215 GACGTGCTCGCTGAACACGGTGCGCACGTACTTGAGCTGCGTCAAGTCGTAGCCGCGGCACAGGTCGTCCACGCACGTGTAGATCGAGGGCGAGCCGTC 157 MD2067 Direct 166533 166631 99 140.5 AACACGGUGCGCACGUACUUGA CGGCACAGGUCGUCCACGCACG
216 ACGACAGACGGCGATAGAGCGGACGTGTCGGTAATGACGGCGCTCGTCGTCACGCCGCTGCTGTTGCCGCTCGTGGT 434 MD2084 Direct 167703 167779 77 122.7 ACGGCGCUCGUCGUCACGCCGC UCACGCCGCUGCUGUUGCCGCU
217 GCGGCCAGGCCCCCCGCGGCCGCTTCTTCATGAGGTCGGCAGACGAAAGCCGGTGAATTCGTTGTAGAGCGGCAGGTGGGGCGCCGC 581 MD2093 Direct 168010 168096 87 116.5 GCGGCCGCUUCUUCAUGAGGUC UGAAUUCGUUGUAGAGCGGCAG
218 TCTGGTAGACGCCCGTCTCGTGGTAGGAGGTAGAGCGCGGCACCACCGGTCGGATGCCCTCCAACACGCGCCCGGGGTCCTGGTGGA 595 MD2096 Direct 168219 168305 87 116.0 UAGACGCCCGUCUCGUGGUAGG GAUGCCCUCCAACACGCGCCCG
219 GTTGTGCAGCTTGAGCAGCGCGCTCTTGAGCGCCTGGAACGCGTTGCCGCACGAGGCGCTGATCTGGATCTGCACGGC 452 MD2100 Direct 168385 168462 78 122.0 CAGCUUGAGCAGCGCGCUCUUG GUUGCCGCACGAGGCGCUGAUC
220 TTGCCGCCGTTGGTGGCTAGGGCGGGCGGCAGGGCCGCGGCGGCGGGCGTGAAGAGCGTGATGGGGCGCTGGTGGCTGGTCAGGTCGATCATGGGCGGCGA 161 MD2106 Direct 168572 168672 101 140.3 GGUGGCUAGGGCGGGCGGCAGG UGGGGCGCUGGUGGCUGGUCAG
221 GGCGCTGGCGGGCTGCGGGTAAGGTGGCGGCTGACCCAGCGGCGGCATGGACATGGGCTGCTGGGCGTGCGCCATCTGCTGTTGCTGCTGCGCC 62 MD2107 Direct 168724 168817 94 154.7 AAGGUGGCGGCUGACCCAGCGG CUGCUGGGCGUGCGCCAUCUGC
222 GGTCATCGAGGGCATGCCGACGGCGCCGGAGGTCCCTGGTGGCAGGCCGTCCTCGGTCAGGTGAATCTCCACCGCCGCCGGTATGTTATCGGCGGTC 199 MD2109 Direct 168820 168916 97 136.5 CGACGGCGCCGGAGGUCCCUGG UGAAUCUCCACCGCCGCCGGUA
223 GGCCGCCGCTGTCGCCGTCGCTCCCGCTGCTGTCGCCGACGCGCGTCGGTCGCGGGAGGCGGGCGACGGGGCCGGC 517 MD2113 Direct 169117 169189 73 119.1 GCUGUCGCCGUCGCUCCCGCUG GUCGGUCGCGGGAGGCGGGCGA
224 GTCGGTCGCGGGAGGCGGGCGACGGGGCCGGCACGATCTTGACGTGCGTGACGTCCTGGTCGTCCGGGGGGATGCGCAAGAGACCCTTCTGCGGCACGAC 558 MD2116 Direct 169161 169260 100 117.4 CGACGGGGCCGGCACGAUCUUG UGACGUCCUGGUCGUCCGGGGG
225 TCCCGGTCGCGTTCTCCAGTTTGATCTTACAGGTGGTGTTGAACAACTTGTAGTCGTAGCTGTACGCGGACTCGCAGGA 507 MD2126 Direct 170238 170316 79 119.5 CAGUUUGAUCUUACAGGUGGUG UUGUAGUCGUAGCUGUACGCGG
226 TCGACTTAGCGGTGGTGATGACAGTCGTCGCCTTGGAGGTACTGATGGCAGCAGTCGTCGCCTCCGAGGTAGGCTTACCGGTGGGAGTCGA 202 MD2128 Direct 170397 170487 91 136.3 UGAUGGCAGCAGUCGUCGCCUC UCGCCUCCGAGGUAGGCUUACC
227 CGTGGCGGCAGCGGTGGTACTCGGGATCACGCTCGTTGTAACGGTACTGTTAGTGGTTACCGACGTGGTGACGGGCACGCTAGTTGAGCTCGCG 370 MD2131 Direct 170518 170611 94 125.6 GUACUGUUAGUGGUUACCGACG UUACCGACGUGGUGACGGGCAC
228 TGAGCTCGCGGTAGTGTTCTTGTCCCCTCGCGCCCCAGTCATGTCGCCGACTAGCGCGGCGATCGCGAAGATCGTCACGAGGGGAGACATGACGGCGTGTGACGGGGACGGGGGGCAGGAGGGTTTA 5 MD2132 Direct 170602 170728 127 185.7 UUCUUGUCCCCUCGCGCCCCAG UCACGAGGGGAGACAUGACGGC
229 TATTGTTCACCTGCATGGAGTTGCACGACTTGATGGCCTCCTCCAGCACCTGGTGGATGCTGGGGATGTTGAAGGGCAGGTTCTTGTACTCCAGCGAGCGAGTGGTG 267 MD2162 Direct 172676 172782 107 132.5 AGCACCUGGUGGAUGCUGGGGA UUGUACUCCAGCGAGCGAGUGG
230 GCTGGGGATGTTGAAGGGCAGGTTCTTGTACTCCAGCGAGCGAGTGGTGTTACGGAACATGCGGTCCACGTCCTCGGT 147 MD2164 Direct 172734 172811 78 141.4 AGGUUCUUGUACUCCAGCGAGC UUACGGAACAUGCGGUCCACGU
231 GTCGGGGGGAGAGATGGGAGAGGAGACGGCGGTGGCCCGCACGTGGGCTGCGATCGCCTCGTCCTCATCTGACTCCTCAGC 6 MD2185 Direct 174185 174265 81 184.9 AGAUGGGAGAGGAGACGGCGGU CCUCGUCCUCAUCUGACUCCUC
232 ATCTCCTGGATGCGACGCGTCATGGTGCTCACCAAGTCCTCTTTGGTGATCTGGGGTTGGCGAGCGATCATGACGCTACTCTCCTCCAGGATGT 156 MD2189 Direct 174351 174444 94 140.6 CAUGGUGCUCACCAAGUCCUCU UGGGGUUGGCGAGCGAUCAUGA
233 CCTCCTCGGGAGAACACTGATGGAAGGACTGCAGGGCCGCGATGGCCGCGCTGGTTCCATTAGTGGTCTTGGGGAAGG 286 MD2192 Direct 174652 174729 78 131.3 UGAUGGAAGGACUGCAGGGCCG UGGUUCCAUUAGUGGUCUUGGG
234 GACAGTGTGGTTGAGCCTGGTGTACTTATGTCTCCCTCTGCTGGCGGCAGTGACGACTGAGCGACAACTACCCTCCACCGCTGTT 505 MD2203 Direct 175729 175813 85 119.6 CCUGGUGUACUUAUGUCUCCCU UGACGACUGAGCGACAACUACC
235 GGATGATGCAATTGGCGTACAGCCAGGCGGGCCATTTACCGTCATTGACGTCAATAGGGGCGTGGTGAACGGTAAATGGCCCACTTGGCAGTACATTCTATGGCTCATATCC 12 MD2216 Direct 176942 177053 112 174.9 CGGGCCAUUUACCGUCAUUGAC CGUGGUGAACGGUAAAUGGCCC
236 GCTCATATCCGTTCCCCGCCCATTGACGTCAATGGAAAGTCCCACCATTGACGTCAATGGGCGGGGGTCGTGGGGC 367 MD2217 Direct 177044 177119 76 125.7 UUCCCCGCCCAUUGACGUCAAU UGACGUCAAUGGGCGGGGGUCG
237 TATCGCCTACGTCATATCGTTGGCATGGGGCCAATGATATCGCGGCCCTATCGTCGATATCGTCCCATGTCGCCGGTCGCTTATGTCGGAACCGCGATA 275 MD2220 Direct 177332 177430 99 131.8 UUGGCAUGGGGCCAAUGAUAUC UCGAUAUCGUCCCAUGUCGCCG
238 TGGTGGCGCGGTGCCGTAGTCCGCGGGGCTCCTGGATCTCCACCTGCAGCTGTATGTTGTCGTACCGGTAGGTCTCACTGCGTCGCACCGTCCAGTTAAGGTGGTAGTCGCGCTCGCCGTTACCGCTGATCACGAAGCTGCTCACCA 397 MD2274 Direct 181120 181266 147 124.3 AGCUGUAUGUUGUCGUACCGGU CGUCGCACCGUCCAGUUAAGGU
239 CCGGTGTCTATCACGGTATAAACTTCCTGTTCCGCGTCGAACACGACGCGGAAGAAGAGGCGGTTAAACTCGTGACGGACGGCCGG 394 MD2292 Direct 182284 182369 86 124.4 CGCGUCGAACACGACGCGGAAG CGGAAGAAGAGGCGGUUAAACU
240 GACCGCCAAAACCTGCCGGCGAGCGCATGTCTCGCTAGCCGTGATTGGCTTGAGGTACTGCGTGCCCGCGGGGATGGTGTTC 475 MD2293 Direct 182409 182490 82 121.1 CGGCGAGCGCAUGUCUCGCUAG UGAGGUACUGCGUGCCCGCGGG
241 TGCATGGAGTGTCCTACATATCAAAATAAATGGTTTTACTGAAGGATACAATTGTTCATGTTGTTTCTTGGTAAATTTGATTATACTGTAACGTTTATGCA 279 MD2299 Direct 183039 183139 101 131.5 UGGAGUGUCCUACAUAUCAAAA UGUUUCUUGGUAAAUUUGAUUA
242 TATACGTAACCTATATAAGAGTAGCCATGTACATCATATTTCAGATAATATGTGTACGTGAGTGAATACTCTTTGGTAAACGGTATA 179 MD2337 Direct 186211 186297 87 138.5 AAGAGUAGCCAUGUACAUCAUA UGUGUACGUGAGUGAAUACUCU
243 GCGGCGGCGTGCAGCACGGCTCGTCGGCCCAGCTCAGCGTCTCCAGATGCGTGAGGACGACGAAGCGCTGCAGGACGAGCGCGTGACTGTCGTTGCGC 121 MD2345 Direct 187046 187143 98 144.4 UGCAGCACGGCUCGUCGGCCCA CGAGCGCGUGACUGUCGUUGCG
244 GCCGTCACAGCGTCTGGTACGGCTGCACGAAGTCGTGGCTGTTGCGCAGGGCGTTGCGGACGGC 48 MD2363 Direct 187979 188042 64 158.3 CUGCACGAAGUCGUGGCUGUUG CUGUUGCGCAGGGCGUUGCGGA
245 GCTGCACGAAGTCGTGGCTGTTGCGCAGGGCGTTGCGGACGGCCTTCCTCACCGCCTGTTGCATGGCGGTCACCACCTCGGGCGGC 69 MD2364 Direct 188000 188085 86 152.7 UGGCUGUUGCGCAGGGCGUUGC UCACCGCCUGUUGCAUGGCGGU
246 GGGCGGCGGGGGCAGGTCGATCAGCAGCTCGCGAGAGTCCTGGTCGCGTTCGGCGTACGACGGACTGCACGGCTGGAAGACCGAGGACCAGTCGTCGATGCTGTCGATCTCCACCGCCGTCT 46 MD2365 Direct 188088 188209 122 158.7 AGUCCUGGUCGCGUUCGGCGUA CACGGCUGGAAGACCGAGGACC
247 GGACCCGACGGAGGACACACTGGTGGAGCGGCTGGCACCGCCGACGCTGCCGGTGCCGCTGCTGCCGCTCTCTGAAGCGTGCCGCGAGGGCC 382 MD2367 Direct 188298 188389 92 125.1 CACACUGGUGGAGCGGCUGGCA CCGGUGCCGCUGCUGCCGCUCU
248 GGCGTTGGAAGAGCTGCTCTGCGACGCGGTTGTAGCAGTGGACAGCGTCGTGCTACTCGTACTGCTGGCAGTAGTCATGGCCGACACGCGGACTGTGCACCAGCTCAGCCGAGGTCTCAGGGGAGACCTCGCTTCAACGCC 170 MD2370 Direct 188556 188696 141 139.8 AGUGGACAGCGUCGUGCUACUC CUCAGGGGAGACCUCGCUUCAA
249 ACATAGATTGTGCCGATCGGTGCGATAGATGTACGCAAGGTAATGTTCATCTTTTGTCCATCGAATTTGAAACAATCGTGT 550 MD2382 Direct 189586 189666 81 117.7 GCCGAUCGGUGCGAUAGAUGUA UUCAUCUUUUGUCCAUCGAAUU
250 GGGGTGTGTGAGTTGCGATGAGGTCGCCGAGGACGGCGAGGCGTCTGCGTGTTAAACGGCTGTACGCGGGGTGTGATGTGCTTTTAAAAAACTGGCTCTAAGTAGTCTTTCTCTGCTGTCCGGTCGCCTGCCCGACCTTGCCGTCTTCGTCTCTCTCACGTCTGCATGGACTCGGCGTCCC 555 MD2410 Direct 191849 192029 181 117.6 UACGCGGGGUGUGAUGUGCUUU UCUUUCUCUGCUGUCCGGUCGC
251 GGCGTCGGCTTGTGCTGCAGCGTCGCCGGCGTCTCCACCTCTCCCGGCCTCGTCGGCTCCGTCGGCGTCCGCGGATCCACGTAGGTCTGCGGTGTCAGCGCCGGTCGCGGCCACACCGGTTTGGGTTTCGTCGGCGGACCCTGTTTCTTGCGACCCGGCGCC 579 MD2416 Direct 192275 192436 162 116.5 UCGGCUCCGUCGGCGUCCGCGG UCUGCGGUGUCAGCGCCGGUCG
252 GGTCGGCTGCGGAGCGGGTGCCGGGACGGGCGTCGGAGTCGGCGCGGGGGTGGTGGGCACGGTGGGGGTGGTCGCCTTCGTTCCCATGTCGCCGCTCGTCTTTTCCTTTTCCGACGTGCTCTTGGACGCGGGTTTCTCGGTGGACT 273 MD2428 Direct 193460 193605 146 131.9 AGCGGGUGCCGGGACGGGCGUC UCGUUCCCAUGUCGCCGCUCGU
253 GGGTTTCTCGGGCTTCTCCGGCTTCGTCTCGGGTTTTGTGTTGGGGTTGGGGATCTCCACCTTGACCTCGCACAGCGGCTGAGACGACGGATCGGACGGACCTTCGCCGGGATCCTC 23 MD2431 Direct 193640 193756 117 168.7 UUCUCGGGCUUCUCCGGCUUCG UGACCUCGCACAGCGGCUGAGA
254 GCGGTCCGTCTCGGCGTCCAGCAGCACGAAATGCGGCGCGCGGTATAGATCCGCCGGCCCGTTTCGTCCGCTGCTGGCGCTGCCGT 321 MD2464 Direct 196273 196358 86 129.0 UCCAGCAGCACGAAAUGCGGCG CCGUUUCGUCCGCUGCUGGCGC
255 GGGACGTGGCCCTGCTGGAAGTTCCGCGCTGGGCCTGGCAGGGCTGGAGGCGGTGGCGGTCCCAGCGCGGGACTTCTTCCTTCCCCGTCTC 405 MD2486 Direct 197340 197430 91 124.1 AAGUUCCGCGCUGGGCCUGGCA UGGCGGUCCCAGCGCGGGACUU
256 TCCCCGTCTCTTTCCTCGCCCCCTCCGTTTTGCCCCCGTCCCCCCAGTCAGCGGCCGCCTCTGTCGCGGCGTCTCTCGGCTCGGCCGTCTCTTTCTCTGATCTGGTCGGCCAGGCCCTGGGCGAGGTCATCGGCTCCTTCGTGGCGTACATCGTTTTGGAGAGGCTCTGGCTCGCCGCCCGGGACTGGGTGTCTGGCCACGACGCCGAAAGCGAAGAGGCCATGGCCAGGCGGCGCCAGCGCATGCTCTGGCGGATGTTCACGCGCGGCGGGCCGGACGGCGCGGAGCAGTGTTCGTTCCGGGGA 266 MD2488 Direct 197421 197725 305 132.6 UCGCCCCCUCCGUUUUGCCCCC CGGGCCGGACGGCGCGGAGCAG
257 ACGGTTGTCGAGGAGTCGGCGGACGAGAGCGGCGGCGAGCTCCTGAGCTCGGGAGCTGGCGCTGCTACTCGCCCTTCCCCGCTGCCCGGTAACGCGT 66 MD2492 Direct 197726 197822 97 153.5 UCGGCGGACGAGAGCGGCGGCG UUCCCCGCUGCCCGGUAACGCG
258 GACCCCTACGGTGACGCTCACGGTGGCTTCCGTTGTGGTGACGGTGGCGGCCATGTTGTATGCGTCATAGCGTAGTGGTC 481 MD2500 Direct 198590 198669 80 120.7 UACGGUGACGCUCACGGUGGCU GCGGCCAUGUUGUAUGCGUCAU
259 GGCACTTGTAAGCCATAGCCTAGAGTGACACTATATTTAGGAGGGTGTTTTTGGGTTTGTTGCCAGGTGACTTTGTAGCATCCTAGTCGAGTACTATTTGTAACAAGTGTGGCTTTTTTGTGGAGACAGTGTC 152 MD2508 Direct 198870 199002 133 141.1 AGGGUGUUUUUGGGUUUGUUGC AGCAUCCUAGUCGAGUACUAUU
260 TGTTGACGAGCATACCGTATCTCCCTGACGTAGACGGTGTATGTTGCAACGAGTCCTAAACAGTAATGGTGTGTTGTACGGTTTTGGTATGTTGCGGCTGAATGGTGTGTTGAACGGCG 494 MD2511 Direct 199188 199306 119 120.0 AGCAUACCGUAUCUCCCUGACG UGUGUUGUACGGUUUUGGUAUG
261 TACCGGTGAAGATTATGGCCAACCCAATTCCCATACTCCGTCGAGTCCGTGGTAGATGTAATGTCCGTATTCTTCAGGTA 511 MD2516 Direct 199403 199482 80 119.3 CCAUACUCCGUCGAGUCCGUGG AUGUAAUGUCCGUAUUCUUCAG
262 GCATGCTCGTCGATGTATTTTGGCAAGTTTTGTGGAGGCATTGAGGCAGATGCCTATTCCGGTGTCGTTATACAGCAGAGCTTCTTTAACGTTGCATGTCGTATGC 457 MD2522 Direct 199619 199724 106 121.7 CAAGUUUUGUGGAGGCAUUGAG AGCUUCUUUAACGUUGCAUGUC
263 CGTGTTTCGGGCCGGCGGGTCGTCGCGGGGACTGGTTTGGCGTGCGTACGTACGTGTTTCTGCACGGCTCCGGCCGCCGCTTCGGCCTCCCTGCACGCCCGCGGCAAGCGACACGCG 168 MD2535 Direct 200531 200647 117 139.9 UGGUUUGGCGUGCGUACGUACG UCGGCCUCCCUGCACGCCCGCG
264 GCTTCTCGCCGTTTGCCTCTGAAAACTACGTGCTCCGCGAGGGCCGAGAGAACACGCGGTTTTCAGGGGTGACGCGCGTGC 375 MD2540 Direct 200879 200959 81 125.4 UUUGCCUCUGAAAACUACGUGC GAGAACACGCGGUUUUCAGGGG
265 TGCGCAAGTGGGCGCAACGAGAGGCCGGCGGTCTGCTCCCGCTGGGCCGGCCGTACGGCTTCTACGCGCGCATCACGCCGCGCA 216 MD2545 Direct 201386 201469 84 135.4 CAACGAGAGGCCGGCGGUCUGC GCCGUACGGCUUCUACGCGCGC
266 TCCGCTACGGCGCCGGCGACGTGGCGCGGCTGTATCGGTCCAACCGGCTGGGGCTGAACGCGCCGCGGGCCACCGCTGTCCCCGAGCCCGCGCTGCTGCGGA 285 MD2554 Direct 201737 201838 102 131.3 GGCGACGUGGCGCGGCUGUAUC UGAACGCGCCGCGGGCCACCGC
267 GCGCGTGGCCCTGCCAGTCGCCGCAGTCGCACCACACGTCGTGGGCCACGTGCACCTGGTGGCGCCACTGCGC 468 MD2583 Direct 204253 204325 73 121.3 CGCACCACACGUCGUGGGCCAC CACGUGCACCUGGUGGCGCCAC
268 GCCACGTGCCGGTAAGACCGGTGGACCATCCCGTACTGCATGTTCCACATGTAGGCATTGGAGGTGTAGTCCACCCGGATCTCGGGCACGCAGGT 560 MD2588 Direct 204995 205089 95 117.3 ACCGGUGGACCAUCCCGUACUG UGUAGUCCACCCGGAUCUCGGG
269 GCGACTCGGTCACTTCCAGGTTATCTCTGTAGGAACGGGACTGGATGCCGAACTGCACGAAGTGTCTTTTGGTGAAATTACCCGAGATCTTCCCCCGAAAGTACACTTTACCCATGTGCAGACGACATTCGTTCTCCTCCACGAGGAAGTGTGTAGGGAGGCCGGTCAGC 155 MD2597 Direct 206165 206334 170 140.8 CACGAAGUGUCUUUUGGUGAAA UUCCCCCGAAAGUACACUUUAC
270 GTGACGTGGGTGAGACCAAGGCAGTGAGCGTTTTCGTCACGTTTGTCATGCGACGCTAGCGGAACATGATAAGCCTGACGAGAAGGTTCGTGTTCTTTGACAGAGCCACGGGAAC 198 MD2619 Direct 207729 207843 115 136.6 CGUUUUCGUCACGUUUGUCAUG AUGAUAAGCCUGACGAGAAGGU
271 GGAAAGGCGAAGGCTTTCGCCACTCCTATCTTGAAAGCGTGTCATTCTTTATGATAGGCGTGACGATGTCTCCGCCTCTCC 605 MD2621 Direct 207914 207994 81 115.6 AAGGCUUUCGCCACUCCUAUCU AUAGGCGUGACGAUGUCUCCGC
272 GTCACGGTGACCGTCGCCGCTGCCGCGGTTATGCGCCCGGCGGGGTGGCGGCGACGGTGGC 141 MD2640 Direct 209727 209787 61 141.8 CGCGGUUAUGCGCCCGGCGGGG GGCGGGGUGGCGGCGACGGUGG
273 GTAACGCTGCTCCACGAACAGGCGCTCCAGGTCCGAGGAGGTCGTGCGCAGCGGCAGCCACGGCAGCCGGAGTACCGGCTGGCAGTGGAGCGAGCTCCGGTTAC 459 MD2646 Direct 209903 210006 104 121.6 ACAGGCGCUCCAGGUCCGAGGA CAGCCACGGCAGCCGGAGUACC
274 GTGGGATTGAGCAAGGCCACTGACGGGGGGGACCTCGTACGTCAGTGTGTTCGTCTGTCCCCGTCAGGGCCTACGCAGGTTCTGTCGCCGC 200 MD2652 Direct 210577 210667 91 136.4 AAGGCCACUGACGGGGGGGACC UUCGUCUGUCCCCGUCAGGGCC
275 GCGTCCCGGGCGTGAACAGTCCGTGCATCTGCAGCGTGCCCGACAAGACATGATTCTTGATCACACAGCTGCAGGTGAAATGGCTGACCTCGTTCGTCGC 54 MD2664 Direct 211186 211285 100 156.6 UGCAUCUGCAGCGUGCCCGACA AUCACACAGCUGCAGGUGAAAU
276 GGCGACGACGATCCTTCCTGCCTGTCCGTCGCGCCGAGGCTCAGCAGCCAGGCGCCGAGGACGCAGCGGATCATCCTCCAGTCGCC 515 MD2665 Direct 211290 211375 86 119.2 UGUCCGUCGCGCCGAGGCUCAG AGGCGCCGAGGACGCAGCGGAU
277 CCGCGCCCACCACCATGACGGACGAGGAGCAGGCGCTGGCCACCACCACCGACAGGGTGGTGACCACGCTGTAGATCGTCAGCACGGTGGCGGACGGCGG 177 MD2749 Direct 217471 217570 100 139.1 GAGCAGGCGCUGGCCACCACCA UGGUGACCACGCUGUAGAUCGU
278 GCGGACGGAGCATTTTTATAGGGATTGTGACGTGCGCGGAGGGACCGCGCCGTCGCGGGACCAGTCTGTGTCTCTGTCGC 259 MD2779 Direct 219914 219993 80 133.0 UGCGCGGAGGGACCGCGCCGUC GCCGUCGCGGGACCAGUCUGUG
279 CTGCGGGATGGCGGCCGTCTCGCGCAGCACCAGGAGCCAGTTGGCCGGGTTACGCAGGGCCACCGTGGTGCCCCGGTGCTGGCGTACGTAGCTCCGCAG 379 MD2810 Direct 223332 223430 99 125.3 CGCAGCACCAGGAGCCAGUUGG CCACCGUGGUGCCCCGGUGCUG
280 CGCCCCGACGCGGGCCGTGTGGCGCCCCGGCGCGGCGTCAAAGCTTAATATAGGGAGCGGTCCCTCTCGAGTCTGGGCCGCCGCGCCGGCGTCACGGCCCGGGAGGTGGGGCG 144 MD2815 Direct 223616 223728 113 141.6 CGGCGCGGCGUCAAAGCUUAAU GGGCCGCCGCGCCGGCGUCACG
281 GCAGCTTCAGCGTCTTGGCGTGGCGCCCGGGCGTGTGGAAGTTCACGTCCCGCCCGTGGTGCTCGCCGACGCAGGCGGC 354 MD2832 Direct 224899 224977 79 126.7 UGGCGCCCGGGCGUGUGGAAGU UCCCGCCCGUGGUGCUCGCCGA
282 CGAGCGACAGCACCTGGTCGACGTGGTTGCGGACCCAGTCGCGCACCACCTCGGCGCTGTGCTGCCGCTCG 93 MD2836 Direct 225349 225419 71 148.3 GGACCCAGUCGCGCACCACCUC CACCACCUCGGCGCUGUGCUGC
283 CCTCGGCGCTGTGCTGCCGCTCGAAGATGGCCTTGAAGTCGCCCATGACCCGTAGGAAGGTTTCGTAGCGCGTATGGCAGTAGAGG 548 MD2837 Direct 225397 225482 86 117.8 GGCGCUGUGCUGCCGCUCGAAG UUUCGUAGCGCGUAUGGCAGUA
284 CGCGTCGTCACCAGGCAGTGCAGACGGGGACCCGTGTCGTCCTGGCGCTCGGCGGCCTCGCGCTCGGCCGCCTGCAGCCCCACGATGTCGGGATCCACCACGTAGGTCTGCGAATTGGTGTCGTAGCG 559 MD2840 Direct 225771 225898 128 117.4 AGACGGGGACCCGUGUCGUCCU CCUGCAGCCCCACGAUGUCGGG
285 CTGTTGCAGCACGCGCCGCTCGCGCTCGCGCCGCTCGTCAGGGTGCCAGGCGTCCTCGTTGAAGAGGATGTCGCGCTTGTGGTCCACGGCGCGCTCGTGGTGGTGCGGGCACAG 28 MD2843 Direct 225986 226099 114 166.8 CUCGUUGAAGAGGAUGUCGCGC GAUGUCGCGCUUGUGGUCCACG
286 TCAGCCGCATAATCACCGTGCCGTAGCCCGGCGTGTGCAGCTTCACGTCGCAGTTCAGGATGCGCTCGGCCGTGGCGTACGAGCCCTCGGGCGTGGTGTCGTTGAGGAACAAGATGTGCATGGTGCGCGCGCCCCGCGGGTAGCGCCGCGGGAGCGGCGGCTGA 301 MD2851 Direct 226447 226610 164 129.8 CCGUGCCGUAGCCCGGCGUGUG UCGGGCGUGGUGUCGUUGAGGA
287 GGCGTAGCCCAGCGGCGTCAGGGGCTCGCCGCAGCACACCAGCTTGCTCGCGGCCTTCTTGGCGCTGACGATGATCTCGTC 436 MD2856 Direct 226829 226909 81 122.6 CGUCAGGGGCUCGCCGCAGCAC UCGCGGCCUUCUUGGCGCUGAC
288 GGTACAGCGCCATGGGGTCCTCGCCCGCCGCCGCGCCGGGCAGGCCCATCAGGGCGTCCAGCGAGGGCAGCTGCGGGGGCACCACGGCGGCC 217 MD2858 Direct 227047 227138 92 135.4 CAGGCCCAUCAGGGCGUCCAGC CGUCCAGCGAGGGCAGCUGCGG
289 GGTACAGCGCCATGGGGTCCTCGCCCGCCGCCGCGCCGGGCAGGCCCATCAGGGCGTCCAGCGAGGGCAGCTGCGGGGGCACCACGGCGGCCAGCGCGGCCTCCGCGGCCCCCTCCGCGCCGGGCCCCCCGGCGAAATCCATGGCGGCGCCGCCCGCAGAGACCCCCGCGCCGAGCC 229 MD2859 Direct 227047 227223 177 134.5 CAGCGAGGGCAGCUGCGGGGGC CCUCCGCGGCCCCCUCCGCGCC
290 GCGCCTCGGTCTGAGAACCGGCCTAGCGTTCGGACCGCAGTCGAGACAGATGACGGTCCGAGCCACTGAGCGGTTCCCAGCCCTGGCGC 3 MD2861 Direct 227268 227356 89 189.2 CGGCCUAGCGUUCGGACCGCAG CGGUCCGAGCCACUGAGCGGUU
291 CACCCGGAGTACGCAAGGGAATACATTCGCCGCGATAGCGACAAGCCACCCGCTGCAGTTCGTTGATGTTGTGGTCGTGCAGCCGCAGGTCGCAGATCATGTTGTCGGGCTGCGTGGTGAGCAGCGGCGTGCGCATCTTGTCGGCGTAGATGACCTCCAGGTG 521 MD2878 Direct 228859 229021 163 119.0 AGCCACCCGCUGCAGUUCGUUG CGCAGAUCAUGUUGUCGGGCUG
292 GGTGGGTCACGTTTGGATGTGCTCGGACCGTGACGGTGGATGTCGTCGCGCCCACGGTCCGGGCACAATCAACCGTGGTTTACT 11 MD2920 Direct 232482 232565 84 176.3 GGAUGUGCUCGGACCGUGACGG CCCACGGUCCGGGCACAAUCAA
293 CCGCGGATGCGTCGCCGGGATCCGGAGCTGCCGCTGCCGTCTCGGCTCCTGGCCCCGGTGGCTCCGACGG 347 MD2936 Direct 233604 233673 70 127.1 AUGCGUCGCCGGGAUCCGGAGC UCGGCUCCUGGCCCCGGUGGCU
294 GCAGCGCTCGCGGGCGCAGGCCCTGCAGCACGAGCGGGACATGTTCTGGCAACGTCGCAAGCGGGCCAAGCGTTCGCGCGCGGC 332 MD2948 Direct 234368 234451 84 128.4 CGCAGGCCCUGCAGCACGAGCG AAGCGGGCCAAGCGUUCGCGCG
295 GAGGCCTACGTGCGGTCCCAGCGGTAGCGGTCCCCCTGGCCTCCGCGGACGCGGGTTTACGGACCGGATATCGGGATAGCTGATAGGCTTT 359 MD2962 Direct 235216 235306 91 126.6 UGCGGUCCCAGCGGUAGCGGUC AUAUCGGGAUAGCUGAUAGGCU
296 ATGCGTCGGCAACAGGTACGGCGTCGGCAGAGCTTTCCATGAACTCAGAGACTGGTTGCGATCAGCGTGCTGGATCGCGGTGCTCTGTGCCGCGACGACGCAT 395 MD2990 Direct 237204 237306 103 124.4 ACAGGUACGGCGUCGGCAGAGC GGUUGCGAUCAGCGUGCUGGAU
297 TATTATTTTTGTACCGGATTCGCTTGTCTTGTGTTCTTTTCGGGGTCGGGAGAGTTCGACAGTTTATGAGATAGGACAGGAAAAGTAAGGATATAAAAGAAATA 231 MD2992 Direct 237386 237489 104 134.4 UACCGGAUUCGCUUGUCUUGUG UAGGACAGGAAAAGUAAGGAUA
298 GACTGGTGCCCAATACCCAGATGGACTCGTCGAGGTCGAACCAGGCGTCGTCGGCGATCGGTCGGCTGGGTCGCCAGTC 497 MD3006 Direct 238184 238262 79 119.9 UACCCAGAUGGACUCGUCGAGG GUCGGCGAUCGGUCGGCUGGGU
299 GAGCGTCGTTGAGGTGATCTTCGACCGCGATAGAATCGCTTAGCCCTTGGTTTTTGGCGGCGAGGGCCAGTACCTCGGATTCTC 568 MD3011 Direct 238478 238561 84 116.9 UGAUCUUCGACCGCGAUAGAAU UUUUUGGCGGCGAGGGCCAGUA
300 GGGCCGCTCCCAGTGCTCGCGGTCGAGGTCGGGCAGGAGGCGCAGGGCGGCCTCGGCGGGCGGGGCGGAGACGCGGCCC 423 MD3014 Direct 238653 238731 79 123.2 CAGUGCUCGCGGUCGAGGUCGG AGGGCGGCCUCGGCGGGCGGGG
301 GTCCGGGCGTCTGCAGCGGGATGCCCGTGTGCTGCCACCGGCGGCGCAGCTCGCGGCCCAGTTCGTTCACGTCGTCGCTCTTGGTCAGCGTCCGCAGCAGCGCGGGCTCGGGGACAGCGGTGGCCCGCGGCGCGTTCAGCCCCAGCCGGTTGGACCGATACAGCCGCGCCACGTCGCCGGCGCCGTAGCGGAACCATTCGTCGGCGTCGCGGGCGGCTAGGGTCAGCGTGTTGCGCTGCAGGTCGTAGATGAACACCCGAAAGTTGACGCCCAGGGC 258 MD3025 Direct 239588 239864 277 133.0 CGGCGCAGCUCGCGGCCCAGUU UUGGACCGAUACAGCCGCGCCA
302 GGCGGCGCCGTGGCTCCCGGGGACGGCAGCGGTTCGTGTCCCGTCGCCGCCTCGTGGACGATGGTGGCCACC 563 MD3029 Direct 239908 239979 72 117.2 CCGUGGCUCCCGGGGACGGCAG UCGCCGCCUCGUGGACGAUGGU
303 ATGGTGGCCACCAGCACGATCCAGGGGTCGCGCGGCGAGAGCTGGCGCAGGTCGGTGGCCCCGACGCCGGCCATCTGGCTGCGCGGCGTGATGCGCGCGTAGAAGCCGTACGGCCGGCCCAGCGGGAGCAGACCGCCGGCCTCTCGTTGCGCCCACTTGCGCATGGCTCGGCTGGTGGTGTTAGCCAT 577 MD3032 Direct 239968 240155 188 116.6 ACGCCGGCCAUCUGGCUGCGCG AGACCGCCGGCCUCUCGUUGCG
304 GCAGGAACCGCTCCGGGCTGTTCCAGAAGTTGAGGCTCGGCGGGGCGCCGGGCGGTCCTCCGCCGATGGCGCCTGCTTGGCCTCCGGCGTGGGGCTTGCACGTGGTGGGGTTGTGC 50 MD3036 Direct 240236 240351 116 157.2 UGAGGCUCGGCGGGGCGCCGGG AUGGCGCCUGCUUGGCCUCCGG
305 GTGCACGCGCGTCACCCCTGAAAACCGCGTGTTCTCTCGGCCCTCGCGGAGCACGTAGTTTTCAGAGGCAAACGGCGAGAAGCGC 212 MD3039 Direct 240555 240639 85 135.6 UCACCCCUGAAAACCGCGUGUU CGGAGCACGUAGUUUUCAGAGG
306 CGTGTTTCGGGCCGGCGGGTCGTCGCGGGGACTGGTTTGGCGTGCGTACGTACGTGTTTCTGCACGGCTCCGGCCGCCGCTTCGGCCTCCCTGCACGCCCGCGGCAAGCGACACGCG 169 MR1 Reverse 79 195 117 139.9 UGGUUUGGCGUGCGUACGUACG UCGGCCUCCCUGCACGCCCGCG
307 CCGGGAGGAGGAGGTCCACGAGCGGGTGAGTGAGCGAGCGGGACGCGGGCCGCGATGAGCGAACCGCCGGCGGCGGTGGCGCCAGGCATGGACGGTCGAGCCCCCGGCCGTCCCTCTGCCTTGTCGTCGTTCGGCGTCGCTCGTCGGCTCCGCCGTCCTTCTCGTCCTCCTCCCCGTCTCGGTCCTCCTCCCGG 34 MR38 Reverse 4237 4430 194 163.4 ACGCGGGCCGCGAUGAGCGAAC UCCUCCCCGUCUCGGUCCUCCU
308 ACCCGGTGTCGGCCCGTGTGTTTTGTGTGTGTCTCTTGACTGTTTCGGGACGGGACGGGGGGGACCGCGCGACGTCGCCGGCGGGACCTAGCGGACGATGGGT 487 MR42 Reverse 4662 4764 103 120.4 GGCCCGUGUGUUUUGUGUGUGU GGACGGGGGGGACCGCGCGACG
309 GGTGTCGGCCCGTGTGTTTTGTGTGTGTCTCTTGACTGTTTCGGGACGGGACGGGGGGGACCGCGCGACGTCGCCGGCGGGACC 506 MR43 Reverse 4677 4760 84 119.6 GUGUUUUGUGUGUGUCUCUUGA GGACGGGGGGGACCGCGCGACG
310 TTCGCGGATGATAGTATGCAGAACGCCGTGGAGACGACGTACTTCAGCGTGAGGGCGTCCCGCTTCATGATGTCCGGATCAAAAGTTGTCCTCTTCCTCGTCGTCGTCCTCCGCGTTTGTGATTAGCGGCGGCTCGTCGTCCCTGAG 313 MR72 Reverse 7123 7269 147 129.3 AUGAUGUCCGGAUCAAAAGUUG AGCGGCGGCUCGUCGUCCCUGA
311 TGTATGTGGCTTATTTTCTTTCCTCATTTTGTGGATTGTGATATTGTAAGGATGGTTCCAAACTGTGCGAGTGCAGTTTTGGAAGGTTGAGTTGACGTGCA 530 MR94 Reverse 8456 8556 101 118.5 GUGGAUUGUGAUAUUGUAAGGA GUGCGAGUGCAGUUUUGGAAGG
312 ACTTTCGCTGTGATATTAATCCACGTCTTAGTTGTTGCGGTATCACATTCAAATTTTGTAGTGTTAGTGGGACTCGCAGGTACTGTAGAGGTGCTAGTGATGACGGTGGTGGT 583 MR106 Reverse 9444 9556 113 116.5 UUAGUUGUUGCGGUAUCACAUU UUAGUGGGACUCGCAGGUACUG
313 GTTCATGTGGTGCTTACACTCCACCCGTACGTCCACCGGAAACGTGTATATTGTCTTGACGGAGTAACACACGGGGTACGTGCCGGTGGCGTTGCGTTTGTACCAGAAGTTGGAC 282 MR124 Reverse 10692 10806 115 131.4 AUAUUGUCUUGACGGAGUAACA UAACACACGGGGUACGUGCCGG
314 GTTGGATCTGGCTATGAAGACGCCGTCACCCACCATACAGCTACACAGCGATACCGTCTCGTTCCCTTTCAGGCGGTACCAGTGTACGTCGTCGTCCTGGGTGAAGTTGGCGTGCAGTGACAGC 362 MR155 Reverse 13204 13327 124 126.5 AUGAAGACGCCGUCACCCACCA UACCAGUGUACGUCGUCGUCCU
315 TATGTGCATTCTGAGTGCTTCGATGCGTCTGGAAGAGTAATGGTTCTTCCAACAGTGTCACACTATAGTTATCGTACGTA 435 MR182 Reverse 15441 15520 80 122.6 UCUGGAAGAGUAAUGGUUCUUC UUCCAACAGUGUCACACUAUAG
316 GTTTTAGGCTTAGTTACCGGCTCTTGTGGCCTCTTTAGAGTAGTCGTCCTCTTAGGCTTTGGCGGTTTAACGATGGTAACCGTAAGTTTAAAAC 613 MR189 Reverse 16140 16233 94 115.2 UAGGCUUAGUUACCGGCUCUUG GAUGGUAACCGUAAGUUUAAAA
317 GGTGACTCGCGCTGAGTCGACTGTCGCCGGGGATTTCCTGCGGTCATTTCCTAGGACCCGCGGTTACAATTCGGTCTGCGGTATCATC 403 MR195 Reverse 16444 16531 88 124.2 GUCGACUGUCGCCGGGGAUUUC UAGGACCCGCGGUUACAAUUCG
318 GGCGGGAACGTGGGTCGCCGCCAGCGGTATCGTCGGCGCTGCTGGTGCTGCCGTTGTCGTCGCTCCTCTTCCCGCT 186 MR203 Reverse 17044 17119 76 137.6 GUGGGUCGCCGCCAGCGGUAUC UGCCGUUGUCGUCGCUCCUCUU
319 ACCGCAATCTCGGCTACGTAACTTGCTGGGATCGGGCGTCCACAGGTACTTGGTTTGCGTGCGCGAGCCGAAAGCCAGGTCGCACGAGCGATCCGTCTTCTGCAGCTCGTGCACGTCGGCCACCAGCGCCGTGCTCTCGGTCACCACGCCGTGGGTCTCGTTGCCGAGCACGCAGTGGT 265 MR224 Reverse 19143 19321 179 132.7 UACUUGGUUUGCGUGCGCGAGC CAGCGCCGUGCUCUCGGUCACC
320 CGCTCTTTCGCCGAGAGAACAGTCTTCGCAGCAACAGGCACAGGCCCCGCCAGAAAGAGAAGTATCGGCGACTGCCGGTACTCTGGGATCTCTGGCGGGTCGTCGGCAGCGGAGGCAACGGTCTATCTCTCCATTGGCGCAGCG 230 MR237 Reverse 21114 21257 144 134.4 AGAGAACAGUCUUCGCAGCAAC UCUGGCGGGUCGUCGGCAGCGG
321 ATATCTCCGTTGGGGTGTCTGCGTCCGGCTCTGACTTCTGGGTGGGTGACGGGTGTATGATGCCCCCCGTAGATGT 442 MR251 Reverse 22030 22105 76 122.4 CUGCGUCCGGCUCUGACUUCUG UGACGGGUGUAUGAUGCCCCCC
322 GAGCCCGCCGGCCCCTGCGCCGTCTGGCTTTCTATGCTCCGCGGGCCCGGCGCCGGCTT 524 MR272 Reverse 24419 24477 59 118.9 UCUGGCUUUCUAUGCUCCGCGG CUCCGCGGGCCCGGCGCCGGCU
323 GGGTGTCCGGCGCCGAGGAACCAAGTCACACATAGCCTCTGAACCAGCGTTCTAGTGAAATGCGTTTTCGGTAACTTTCACTAGAAGGCTAGTTACACAGGCCATGGGAAAACAACAGTGCGTCCGACGCTC 294 MR286 Reverse 25290 25421 132 130.6 CUGAACCAGCGUUCUAGUGAAA ACUUUCACUAGAAGGCUAGUUA
324 ACCTGTGTACAGAATAAAAGCCTTTTTATTTTTGATATCAAAAATGAATGGTGTGTTGTTTTTGTTTCGCGGGT 476 MR289 Reverse 25431 25504 74 121.0 UAUUUUUGAUAUCAAAAAUGAA AUGAAUGGUGUGUUGUUUUUGU
325 CAGCGTGCTGGACCGCTGGAAGCCTCCCCTGGAGAGCCGGCCCTGGAAGCGCGGACAGCGCGTGGCCCTGGCCTGGCCTCGAGACCGGTGCCTGGTGGTGCAGCAGCGCTG 124 MR305 Reverse 26288 26398 111 144.2 AGCCGGCCCUGGAAGCGCGGAC GGCCCUGGCCUGGCCUCGAGAC
326 TCTACCGCGGTTTCCTTGACGAACTCGAAGGATGATCTGGTGTCCGAGGAGGCGCTGTAAGAGGACAAGCCCGCCTCCATGCGGTCGAGGTCCTCCGTGCCGTTACGAGACCGCGGCTGGA 290 MR322 Reverse 27875 27995 121 130.9 UGAUCUGGUGUCCGAGGAGGCG CCGCCUCCAUGCGGUCGAGGUC
327 GCGCTAGGGCGGTGGCGCGGCCCGCGCGCGTCTGGTTGTCGGCGTGCGCCACCATCTGGCGC 311 MR336 Reverse 28749 28810 62 129.4 UAGGGCGGUGGCGCGGCCCGCG CGGCGUGCGCCACCAUCUGGCG
328 TGAGCGCGCCCTGGTGGTCGTCGTTGAGCTTCTGCAGGTTCTGACGGTAGAGGTAGAGGGCGCCGCGCGTGGTATAGTGCGCCA 289 MR339 Reverse 28967 29050 84 131.1 UGCAGGUUCUGACGGUAGAGGU UAGAGGUAGAGGGCGCCGCGCG
329 GGCGCGAGTGGTTGGGGTCCCGCAGCAGCCGGTCGCGGATCATGAACTGGCCCACGCGCTGGTTGTAGCTGTCACCGGGGCCCGGACTGTCCTCGTCGTC 126 MR347 Reverse 29434 29533 100 144.2 UCCCGCAGCAGCCGGUCGCGGA UGGCCCACGCGCUGGUUGUAGC
330 GCCGACTCGCTGGCGCAGTTGCTGGAGCGCGGTCTGCTGAAGAGCTACTTCGACGACGTGGAGCGCGCCCGCCAGGGTCAGCTGCGCCACGGC 401 MR357 Reverse 30291 30383 93 124.2 CAGUUGCUGGAGCGCGGUCUGC GCCAGGGUCAGCUGCGCCACGG
331 CAGCGTACTGTGCTACGAGATCGGCAAGGAGAACTTTGTGGTGCGCGCCGCCGACTCGCTGGCGCAGTTGCTG 554 MR358 Reverse 30360 30432 73 117.6 UGUGCUACGAGAUCGGCAAGGA GCCGCCGACUCGCUGGCGCAGU
332 GGCGACGGCAGCGTACTGTGCTACGAGATCGGCAAGGAGAACTTTGTGGTGCGCGCCGCCGACTCGCT 553 MR359 Reverse 30373 30440 68 117.6 CGGCAGCGUACUGUGCUACGAG UUUGUGGUGCGCGCCGCCGACU
333 GGCTTACTGGAAACTGCTGGTGGTGACGGAGGGGCAGGTGCGCGTCATCGGCACCCTCGGCCGCCTGGACATGTTCAGCTGGGACC 439 MR360 Reverse 30461 30546 86 122.4 GCAGGUGCGCGUCAUCGGCACC CGGCACCCUCGGCCGCCUGGAC
334 CGGTGGACGGCTTCGTGGAGAGTTTCTGCGACTTTCTCGACGTGATCCACCG 518 MR367 Reverse 31223 31274 52 119.1 UGGAGAGUUUCUGCGACUUUCU GACUUUCUCGACGUGAUCCACC
335 ACGCCGGGAACTGTCGCGGTTCCGCAAGCACGTCCACGATCTGAAGCGCGTTCGCTTTACGGTGGACGGCTTCGTGGAGAGTTTCTGCGACTTTCTCGACGT 88 MR368 Reverse 31232 31333 102 149.3 UGUCGCGGUUCCGCAAGCACGU CUUUACGGUGGACGGCUUCGUG
336 GTCTGGCCCATTCGGCCGAGGTCACGGCTCACGGCAAGTATGACATCCGGGGCCTGACGCTCGAGTGGGACCTGGC 570 MR379 Reverse 32270 32345 76 116.8 AUUCGGCCGAGGUCACGGCUCA CGGGGCCUGACGCUCGAGUGGG
337 GGGCTCCTTCTGGTTCCGTTGTCCGCGCCGTTTCTGTTTCTCGCCCTTGGGCTCTCCGGCCGCCACCTACGCCGGGGGCGGCGGGCACGGCGGCAGCACCGGCGGCGCGGGCGCCAAACCGATCGGCCTCCAGA 207 MR387 Reverse 32894 33019 126 136.1 CACCUACGCCGGGGGCGGCGGG GCGGCGGGCACGGCGGCAGCAC
338 GGCACGGCGCTGGTCAAGCTGGCCGAGAGCCTGCGGGGCTTCATCCGCCAGGGCTCCTTCTGGTTCCGTTGTCCGCGCCGTTTC 500 MR388 Reverse 32994 33077 84 119.8 CUGGUCAAGCUGGCCGAGAGCC CAGGGCUCCUUCUGGUUCCGUU
339 GCCGCTCTCGTCACTCTACCTGCGCGGGCAGCCCAAGTTCAGCAGCCTCTGGCGGGGACTACGCGACGCCTGGATCCACAAGCGTCAGAAGTTGCGGGAGCGCTTGGGCGGAGTCCAGCTGCAGCGTTACGTGCGGGCCACGGC 197 MR401 Reverse 33715 33858 144 136.6 UACCUGCGCGGGCAGCCCAAGU AGAAGUUGCGGGAGCGCUUGGG
340 GCGACTACGAGGGTCTGCGCCGCTACCTGCTGCGCTTCGAGGGCGCCTGCGTCTCGCTGGGCTGGCCCTCGCAGTGCTTCTACGTGGTGGGCGGCTCTCACTCGC 77 MR416 Reverse 34886 34990 105 151.1 UGCGCUUCGAGGGCGCCUGCGU UACGUGGUGGGCGGCUCUCACU
341 CGGCGGCGGGCTTACGGCGAAGAGGGCCAAGACGGTCGTGGGGCCGCCACCTCCGTCGCCGTCGCTGACCAAGCCCGGTTCGTCG 578 MR425 Reverse 36021 36105 85 116.6 CGUGGGGCCGCCACCUCCGUCG CUCCGUCGCCGUCGCUGACCAA
342 GCCTTCTCCGTCACGCTCGAGGCGCTGTTGTACTGCTCGGTGATGCTCATCAGGTAGTGCTCGTAGGCCGTCAGGTGATAGGACGAGCGGT 142 MR431 Reverse 36380 36470 91 141.7 CGAGGCGCUGUUGUACUGCUCG GGUAGUGCUCGUAGGCCGUCAG
343 TGGAGCACAGCAGGAAGAAGAGCTCGGCGCTGGACGATTTGGGCGTCACGATGTTGCTCCAGTCGTACTTGTAGCCCGTGCCCTGGCTGTTGTTGTA 356 MR433 Reverse 36514 36610 97 126.7 CUCGGCGCUGGACGAUUUGGGC CAGUCGUACUUGUAGCCCGUGC
344 GAAGCAGAAGCCGCGCGGCATGTTGCGCGCCGTGATCTTGTCCGACACGCGGTGGCAGTACGAGGTGGAGATGGTGCCCAGCAGCTGCCGGTTTTCGGCGTC 280 MR443 Reverse 37096 37197 102 131.5 UGUUGCGCGCCGUGAUCUUGUC CCCAGCAGCUGCCGGUUUUCGG
345 CTCCGCGGCTCACCGTGACGTTGTGCAGCAAGGTGTCCATGGCGCGGGCCCCGCCCCGAGGCGAATAGCTGACCGCGCCGGGAGTCCGGAG 512 MR474 Reverse 40834 40924 91 119.3 AUGGCGCGGGCCCCGCCCCGAG AAUAGCUGACCGCGCCGGGAGU
346 ACCACGGGCGCCACGCCCCAGACCACGGTCAGCAACACTTTCCAGGACATGAGCACCGTGTATACCTCGTCGGCTACGAAGTACATGACGCAGGTGTGATAGGAAGCGTTGGTGTTATTGGTGTCGCTGCCGTTACTGGTGTCGCTGGCGTTCATGGT 399 MR482 Reverse 41538 41695 158 124.3 UGAGCACCGUGUAUACCUCGUC CUGGUGUCGCUGGCGUUCAUGG
347 ATGGACACGTAGGGCGTCTGCAGGATGACGAAGGAGAGCAGCAGGACGCTGACGAAGGTCAGGGTGCGGCTCTTTTTCTTCTGGGCCGTACGTCGTACCGTGT 59 MR484 Reverse 41728 41826 99 155.2 UGACGAAGGAGAGCAGCAGGAC UGCGGCUCUUUUUCUUCUGGGC
348 GCAGCTGCGTGGTGCCGGCGGCGTCTGTCGTGCCGCCGTGTTGCTGCTGCGACCTTAAGAAGGCGCGGCGGTCGAACAGCTGCCCCCGGATGCACTGTCGCAGCCGC 18 MR489 Reverse 41987 42093 107 170.1 UCUGUCGUGCCGCCGUGUUGCU CGCGGCGGUCGAACAGCUGCCC
349 GCGATTGCGACAGCCGCTGGCCCAGGGAAACGCCGTGCTGTCTGCACGTGGTTTTCGGACGCGATTTCGGCGTGTCTCCCGGCACGTTGAAAGTCTGACCGCGTTTGACGCGCGCGGGCTTGGTGCCAGACGAGGTCTTGCCGTGCTCGC 73 MR492 Reverse 42124 42273 150 151.8 GGCGUGUCUCCCGGCACGUUGA CACGUUGAAAGUCUGACCGCGU
350 GTCTGCACGTGGTTTTCGGACGCGATTTCGGCGTGTCTCCCGGCACGTTGAAAGTCTGACCGCGTTTGACGCGCGCGGGC 300 MR494 Reverse 42155 42234 80 130.0 GGCGUGUCUCCCGGCACGUUGA UUGAAAGUCUGACCGCGUUUGA
351 AGACCAGCTGGTTGAAGAGCGTGCAGACGCGCGACACGGCCGTCTGCAGGTCGTCGGTGGGCGCCGGCGGGTCGCGCTCGCTGGGCTGCAGGCGGCAGCGGATGTTGCTCGTCACCTGTTGGATCT 174 MR504 Reverse 42964 43089 126 139.2 CCGUCUGCAGGUCGUCGGUGGG CUCGCUGGGCUGCAGGCGGCAG
352 GCGGCTCGACGGGAGAGGGGGCGGCAGGCGCTGACGGATGTTGGCCGCCGCGGCCAGCACGGCCGCCGCGCTGGCCCGCTGTGAGAGTTCCAGGGCCGCCGCCGCCTCCTCGTCGGGCACGC 516 MR512 Reverse 43471 43592 122 119.2 CGACGGGAGAGGGGGCGGCAGG UGGCCCGCUGUGAGAGUUCCAG
353 TCCGGCGGCGGCCGCCGCCTCCTCCTCGTCCTCGTTGTCGTCGCGCTCGTCGTCCTCGTCGCCGCCCGAGGAGCGGTGCTTGACGCGGCGCCGGCGGCGGGGAGCGGGAGGGCGGCTCGACGGGAGAGGGGGCGGCAGGCGCTGACGGA 14 MR513 Reverse 43555 43703 149 173.5 UCGUCGUCCUCGUCGCCGCCCG GAGGGGGCGGCAGGCGCUGACG
354 GCCTCCTCCTCGTCCTCGTTGTCGTCGCGCTCGTCGTCCTCGTCGCCGCCCGAGGAGCGGTGCTTGACGCGGCGCCGGCGGCGGGGAGCGGGAGGGCGGCTCGACGGGAGAGGGGGCGGC 36 MR514 Reverse 43568 43687 120 162.5 UCGUCGUCCUCGUCGCCGCCCG ACGCGGCGCCGGCGGCGGGGAG
355 TCCTCCTCGTCCTCGTTGTCGTCGCGCTCGTCGTCCTCGTCGCCGCCCGAGGAGCGGTGCTTGACGCGGCGCCGGCGGCGGGGAGCGGGAGGG 108 MR515 Reverse 43592 43684 93 146.1 CUCGUUGUCGUCGCGCUCGUCG GUGCUUGACGCGGCGCCGGCGG
356 GGTCCACCAGGATGTCGCGGCTGTTGCGGTAGTGGTTGGCCAGGATGCAGATCTTGACGATCTGCTGGGCCACCGGCTTGACCCGCAGGTAGGGGTTGCGGATCTGGAAGTCC 612 MR521 Reverse 44102 44214 113 115.3 ACCAGGAUGUCGCGGCUGUUGC UGCUGGGCCACCGGCUUGACCC
357 AAGTACAGGTCGTTGAGGGCGTCCTCATGTGAGCGCGTGCCGGGCCGCTTGATGCTGGCCATGCAGCGCATGGGCCGGTTGTTGCGCTGCGTCACGTTGGACAGGTTCTCGGCGAACACTT 17 MR530 Reverse 44512 44632 121 171.5 UGCUGGCCAUGCAGCGCAUGGG CAUGGGCCGGUUGUUGCGCUGC
358 GGTCTCGCCCTGCACGGCCGTGGGATCGGATTCCAGATCGAGCGAGATCTCGCGCGGCAGGGTTCGGGGATC 418 MR537 Reverse 45021 45092 72 123.4 CCUGCACGGCCGUGGGAUCGGA GAUCUCGCGCGGCAGGGUUCGG
359 CGGTGGTGATCTCTCCGTTGTGGATGTTGTAGAAGATCTGCGGGATGTCCTGCCGGTGCACGAACATACGGCGCCGCAGGTAGCGGCTGGGGTGATCGGGCACGCGGAAGATGTCCGGGTTTCCGTACAGGTTCTTGGAGAGGAAGAAGGTCTCGCCCTG 600 MR538 Reverse 45081 45240 160 115.8 UAGAAGAUCUGCGGGAUGUCCU UGUCCGGGUUUCCGUACAGGUU
360 CGGCGCCCGGTCCATGATCTCCAGGAAGCGCTTGGGGGTCAGGCCCGTCTGCCG 244 MR542 Reverse 45291 45344 54 133.9 UCCAGGAAGCGCUUGGGGGUCA UUGGGGGUCAGGCCCGUCUGCC
361 CTCAGGGTCTCGGCCAGTCCGTCGCGGGGGTCCTCGTCATCGTCGCCGCGGTACGGTGTCCGCTCGGTGTCCGGCCCCTGATAGCGGGTGTGCGCCGGACCCCGCGGAGCCGGCGGCGGTGGCCGTCTGCGTCGGCGCTGATGTCGGTGCTGGTTGTAGGCCACCGAG 98 MR552 Reverse 45638 45805 168 147.6 UCGGCCAGUCCGUCGCGGGGGU CGGCGCUGAUGUCGGUGCUGGU
362 GGGTCTCGGCCAGTCCGTCGCGGGGGTCCTCGTCATCGTCGCCGCGGTACGGTGTCCGCTCGGTGTCCGGCCCCTGATAGCGGGTGTGCGCCGGACCC 528 MR554 Reverse 45704 45801 98 118.6 GUCGCCGCGGUACGGUGUCCGC CCGCUCGGUGUCCGGCCCCUGA
363 AGATGGGTACCGTCTGCTCTCAAGGTAAGCCCACGACGTTGGAGACACCTGGAAAGAGGACGTTCGCTCGGCACGCTCCTTCCAGGTGTCTTCAACGTACGTGGCTTTTTCTCTTCTCAGGTGCCTACGTCT 8 MR572 Reverse 47294 47425 132 180.6 CAAGGUAAGCCCACGACGUUGG GCUCCUUCCAGGUGUCUUCAAC
364 CTGGGCCATGATCAGCATGTTCTCGGCCACGGCGGGCACGCTCGTCATACTCAG 552 MR581 Reverse 47886 47939 54 117.6 CAUGAUCAGCAUGUUCUCGGCC GCGGGCACGCUCGUCAUACUCA
365 CGGGCCGAGGACCCGCTGCCTCCCTGGCTGAGGAGCGAGGTGCGGCGGCAGCAGCGGCGGACCCGGCTGCAGCGGCAGTACGGCGTGATCGAGGGCGAGGAGTGGCCCCGCGACCTG 443 MR614 Reverse 50282 50398 117 122.3 CCGCUGCCUCCCUGGCUGAGGA UGCAGCGGCAGUACGGCGUGAU
366 GGCTTTCGGCTCCGTCCACCGCTGAGGAGCGATGTCGGCGATGTCTCTGCCCTACGTCCACCTCGTCGGTGGTGTGGGCCTGCT 283 MR615 Reverse 50439 50522 84 131.4 CGUCCACCGCUGAGGAGCGAUG UACGUCCACCUCGUCGGUGGUG
367 GCCAAAATCCACGTGTCTTGGGCGCGTCATGTCCGGCGTCTTAAGAAGATATATAAGACACCGTCTCAAGACGACGTGTCACCGACACGCGGCTTTCGGC 337 MR618 Reverse 50513 50612 100 128.0 UGGGCGCGUCAUGUCCGGCGUC AGACACCGUCUCAAGACGACGU
368 TCTGGATCAGAGCTGGAAATGGAGCGCGGCCCTCATGGTGGTCGCTGTATTAGGGATCATTTTCTTGGCCGTGGTGTTCACGGTGGTTCTGAACCGGA 111 MR635 Reverse 52083 52180 98 145.6 UGGUCGCUGUAUUAGGGAUCAU GGGAUCAUUUUCUUGGCCGUGG
369 TCCTGGTTAACGAGTGCGGCCTGGTCTTCGGTGTACATCCGGAGACCAACCGGGCTCACTTTCTAGCGCGCGGA 502 MR640 Reverse 52759 52832 74 119.7 UUAACGAGUGCGGCCUGGUCUU GGAGACCAACCGGGCUCACUUU
370 GGTGTTCCTCTGCTGCGACCGCTTTCTGCTGCCGGTGGGCACGGCCTGCCAGGGCGAGCCGGGCCGCGCGCCGCTGGCCATCTTCATCGGCGAGGGCGGCCGCGTGTACTGTTACGCGCC 260 MR648 Reverse 53207 53326 120 133.0 UGCUGCCGGUGGGCACGGCCUG CGGGCCGCGCGCCGCUGGCCAU
371 CTGCGTGTACGACGAGGAGACGGTGTGGTCGCTGTGTCCGCTCAACCGCGAGTGCTACTTCCCCTCGTCGGCGCGG 312 MR667 Reverse 55601 55676 76 129.4 UACGACGAGGAGACGGUGUGGU AGUGCUACUUCCCCUCGUCGGC
372 CAGTTCCTCTCGGTGGGGCCCGACGACGAGGTGGCGCACCTGTGGAGCGTGACGCCCTCGGTGTGGGCCGCGCGGGACTG 588 MR668 Reverse 55674 55753 80 116.3 GGCCCGACGACGAGGUGGCGCA GACGCCCUCGGUGUGGGCCGCG
373 CGCTGGGAGGCGCTGCGCGCCGACATGCTGGAGCACGGGATGCGCAACTGCCAGTTCCTCTCGGTG 543 MR669 Reverse 55739 55804 66 118.0 GGAGGCGCUGCGCGCCGACAUG CGCAACUGCCAGUUCCUCUCGG
374 GGCGGCTACTGCGACCTGGTGCGCGAGCGGGAGGTGCACCGGCCCGTGGTGCGCTTCTTCGTGGACCTCTGGGACGTGGCGGCC 325 MR684 Reverse 56672 56752 81 128.9 UGGUGCGCGAGCGGGAGGUGCA UGCGCUUCUUCGUGGACCUCUG
375 GCACGGCGCTGTGGCGCGAGATCGACGCCCTGGCGCGTCACGGCGGCGGTCTGGGCAGCTTCAGGCTCTTTCAGATGGTCATGCGCCACGGGCCCTCGCTTATCCACCAGTCGCCGCGC 390 MR693 Reverse 57356 57474 119 124.7 UGGCGCGAGAUCGACGCCCUGG UCAGAUGGUCAUGCGCCACGGG
376 CGGTTCCGCTTTTGCGGCGTGCAGGAGCCCGTCCGCGAGACGGTGGGCGACCGCACGGCGCTGTGGCGCGAGATCG 572 MR694 Reverse 57451 57526 76 116.7 UGCAGGAGCCCGUCCGCGAGAC UGGGCGACCGCACGGCGCUGUG
377 TGAGAACGGCGATTGTGGGATCGTCGCCGTCGGTCCTGTACTGGGCGACGGCGATCTCTTCTGCGACTCGTTGCTCTCA 45 MR699 Reverse 57779 57857 79 158.8 AUUGUGGGAUCGUCGCCGUCGG GACGGCGAUCUCUUCUGCGACU
378 GAGGGCCTGGTGGAGTTCGAGGCGCAGCCCGGATCGCTCATCCTGCGCATGGAGACGGGCTGCGACTCGCCGCGCCACCTCTACGTGGGCCTTT 358 MR716 Reverse 58930 59023 94 126.7 AGUUCGAGGCGCAGCCCGGAUC ACGGGCUGCGACUCGCCGCGCC
379 GCGGCGCCGGACGCGGGAAAGGGGTGCTGCGATTCGACGATGGTGAAGAGCTCGCGCACGGCTTCGATGAGCTTTTTGAAGGCGTCGAGGGTCTTGGTGTTGTCGTAGACCTCGAGCTCGCTGCCGGCGGCGGCGCCGC 56 MR722 Reverse 59494 59632 139 155.8 AGGGGUGCUGCGAUUCGACGAU GAAGGCGUCGAGGGUCUUGGUG
380 GCTCGGCGTTGGTGGTGCCGCGCGTGTGGGCCTCGAACTGCTCCTCGGTGTACCGCAGGGGGAAGTAGGCGCGCACGTTGAGCAGCACCGTCTCCCAGATGCCGTGC 154 MR741 Reverse 60587 60693 107 140.8 UCCUCGGUGUACCGCAGGGGGA CAGGGGGAAGUAGGCGCGCACG
381 CGCGGCTCAGCGCCAAGCAGTAACAGAGGCGCGTGTGGCGAATGAAGTTCTGCAGGCTGCCGCTGCTGCTGCGCGTGATGTCGCG 483 MR749 Reverse 61275 61359 85 120.6 CAAGCAGUAACAGAGGCGCGUG AGGCUGCCGCUGCUGCUGCGCG
382 GCGGGCCGTGGGCAGGTGCAGGTGACGCGACTCGATCTCCAGGTAGACGGTCTGCATGTCCTTGGACAGGTGCGCGCGGCTCAGC 323 MR750 Reverse 61349 61433 85 129.0 AGGUGCAGGUGACGCGACUCGA ACGGUCUGCAUGUCCUUGGACA
383 ACCTGCTTGACGCGCGTGCGGATGACCTGCAGCCGCTCGCTCAGGTGCCGCATGCTGTCGCTGAGCAGTTTGTCGGCCCGTATGAGGTCCTTGAGCTGTTGCAGGAAGCGGGCCGTGGGCAGGT 270 MR752 Reverse 61417 61540 124 132.2 AGCCGCUCGCUCAGGUGCCGCA UUGUCGGCCCGUAUGAGGUCCU
384 GGCCACGCGAGTAGCGGCTGATCTCTTCCGTGTCTTGCGTCACCTGCTTGACGCGCGTGCGGATGACCTGCAGCCGCTCGCTCAGGTGCC 262 MR755 Reverse 61492 61581 90 132.9 UGCGUCACCUGCUUGACGCGCG CGUGCGGAUGACCUGCAGCCGC
385 GTCAGGGCCTTGGACACCTCGCGCTTGTTGATTTCGGTGCTACCGATATCGTGGATGTCGATGCTGATCAGCATGCCCGCCAGCTGGTTGTAGAGGTTCTGGC 380 MR787 Reverse 63831 63933 103 125.2 CCGAUAUCGUGGAUGUCGAUGC GAUGCUGAUCAGCAUGCCCGCC
386 CCGCGCTGCGGGGAGGGGTCCTTGACCAGGTTCTCCAGACTGAAGATCAGGTCCTGTACCTGGATGAGCACGTCCTCGCGCTGCTGCGTGG 424 MR791 Reverse 64281 64371 91 123.2 CUGCGGGGAGGGGUCCUUGACC UGUACCUGGAUGAGCACGUCCU
387 TCGGCGTCGCCCAGCTGACAGCGCTCGATGAAGGTCGCCTGCCTGGTCACCTCGTCCAGGGTGCGTTGGGTCTCCTGCATCAGACGGGGACCCATGACCCGGCGCAGGTGGGTCAGGGAGGCGCGCGTCTGAGTGGCGTGCTCGGCGTACGATCGG 24 MR810 Reverse 65452 65607 156 167.8 UCCAGGGUGCGUUGGGUCUCCU GGACCCAUGACCCGGCGCAGGU
388 GGTCGGGCAGGGGCGCGTCGGAGCTCAGACGCACGTTGCGCTGGCGCGCCAGGTCGGTGAAGCGCGTCTTGAGGTCGGCGATCTTGTCCAGCT 40 MR824 Reverse 66594 66686 93 159.5 UGGCGCGCCAGGUCGGUGAAGC UUGAGGUCGGCGAUCUUGUCCA
389 TGCTGGTGTTGCTCAGGGCGTTGTTGACGATGTCGCGTTGGATGCCCGTGGTCAGGGAGGCCAGCGACATCTGCA 327 MR835 Reverse 67446 67520 75 128.7 UGUCGCGUUGGAUGCCCGUGGU CCGUGGUCAGGGAGGCCAGCGA
390 GTTGGCGACTCTGGCCCGCGGGGCCCGCCGCCTGACACAGTTGGCGCATGATCTCCGAGTCCCAGAACAGCTTGCTCAGCGACACCTGGGGCCACAGGGTGCGGTCGAAGGCGAAGCCCTTCACCTGGTCGCCCGAGTAGTCGGGGGGCATGCTGGTGTTGCTCAGGGCGTTGTTGACGATGTCGCGTTGGATGCCCGTGGTCAGGGAGGCCAGC 384 MR836 Reverse 67456 67670 215 124.9 UGACACAGUUGGCGCAUGAUCU CUUCACCUGGUCGCCCGAGUAG
391 GCTGGGTCTGGGTGTTGGCTTCGTTCAGCAGCCGGCACTGTTGCGAGAAGATCTTGAAGAGCACTTGCACCAGCTCCTGGACGGAGGCGTAGACCTCGGC 495 MR843 Reverse 67763 67862 100 119.9 UUCAGCAGCCGGCACUGUUGCG ACUUGCACCAGCUCCUGGACGG
392 CGTCCAGGGGATACGGGACGAAGGGATTCTCCACCGTCAGGCGGGGGATCTCGTGCCGCTGTCCCGGGGTCG 328 MR855 Reverse 68337 68408 72 128.7 UACGGGACGAAGGGAUUCUCCA CGGGGGAUCUCGUGCCGCUGUC
393 GGGTCGTTGAAGGTCTGCGTGGACAGCGCCGAGTCGAAGAAGGCCGAGGTCCCGTAGTCTTCGGGATCC 501 MR862 Reverse 68659 68727 69 119.8 AAGGUCUGCGUGGACAGCGCCG AGGUCCCGUAGUCUUCGGGAUC
394 GAGGCGGTCACGTCGGTGTTTAAGCGGCTGGTGATGACCAAGCCTTACTTTGTCTTCCTAGCCTACGTATACTCCATGAACTGCTTC 371 MR885 Reverse 70522 70608 87 125.5 AAGCCUUACUUUGUCUUCCUAG CUUCCUAGCCUACGUAUACUCC
395 TGCAGCTGGTGATCGGCCGCGGCGCGCTGCAGCTGGACGAAGTGCCGGTACATCCGGCGCAGGCGCCGACGCAGCTTGCGGCGCAGACGCCGTCGGTTTTCCAGCAGCA 320 MR888 Reverse 70745 70853 109 129.0 AUCGGCCGCGGCGCGCUGCAGC UGCGGCGCAGACGCCGUCGGUU
396 CGGCTCTGACGGCGCTGCTGGCCCTGGTGTGGCGATATGTCGTCGTTGCTCTCCTCCTGGGAGGCGGCGGCGGGGGACGCTTTCCATGAGGCCTTGCTGCGCCTCTTCGGGCCG 531 MR891 Reverse 70882 70995 114 118.4 UGACGGCGCUGCUGGCCCUGGU GCGGCGGCGGGGGACGCUUUCC
397 GAGGCAACAGCAGAGGAGGAGGCGGCGACGAGTCCCCCGACGTCCCCCAAGAGCGACGTGCGTCGTCGACGCGACTACGATCAGCAACGTCGGCCCATGGCGCCGCGCTTTGGGCGCTCGAGGGACTATCCTCCGCCGGTCTCCAGCCAGCGTC 243 MR893 Reverse 71086 71239 154 133.9 GGCGGCGACGAGUCCCCCGACG AACGUCGGCCCAUGGCGCCGCG
398 TCTTCCTCAGTGCCTCCGCCGCTGGTGATCGACGAGGACGCCGAGTACGGGCTGGGCGAGGCGGAAGATGACCTGCTGGTGCAGTTCGAGCCGATGTTACCGCGCGTTTACGATCTGCTGCTGCCCTCGCTGGACGCGCGGTTAAATTTCGTGAACGCGGGCCAGAAGTACGCCGCCTTCCTCAAGTACGTGCACGGCGAGTGCGCCTCGTGCAGTCACGGGCAGATCCTGCGCGAGAAGA 102 MR905 Reverse 72264 72504 241 147.4 UGGUGAUCGACGAGGACGCCGA CUGGACGCGCGGUUAAAUUUCG
399 CAGCTCCGCGTCCAGGTCGCAGGCCGAGGCGGCGCCGCCGCCGCTGCCCCCGCCGTGCAGCACCTCCGTGGCCACGGTGGATTGCGTGGCGCTGCGGTGGCCGGCGGAGCTGAGGGTCACCGACATGGCGTGGTCGTCGAAGTTG 15 MR916 Reverse 73122 73266 145 172.8 GCCGCCGCCGCUGCCCCCGCCG GAUUGCGUGGCGCUGCGGUGGC
400 GTGCAGGTCGGGGAAGTGGCGGCGCAGCAGGTGGATGAACTCGGACATGACGATGAGCGTGCTGAGGGCCGTGCGCGGCGCGTAGTTGCACTTGAAGCAC 535 MR920 Reverse 73413 73512 100 118.3 CAGCAGGUGGAUGAACUCGGAC GUGCUGAGGGCCGUGCGCGGCG
401 AGAGCTCGCGCAGTACCAGGTTGTCGTAGTACGAGCAGGACATGAGCTCGCACAGCAGGCACACGGTGCTGGTCTGGTTCT 386 MR928 Reverse 74024 74104 81 124.9 CCAGGUUGUCGUAGUACGAGCA CACAGCAGGCACACGGUGCUGG
402 GACGGCGTCGGGCCGCGCGCCGGGCGCCGCGGCGCAGTCGGCCAGCGGCACCTGGGCCCCGTGGCGCGCCACGTCGTC 330 MR930 Reverse 74215 74292 78 128.6 CGUCGGGCCGCGCGCCGGGCGC CAGCGGCACCUGGGCCCCGUGG
403 GGAGAGCAGGGAGCCGCTGCCGCGGCGCCGCCGTCGCTGCTGCTTGCGGTAGAGCGAGCGCAGGGCCGAGCGGCGCTCCAGGGTCCCGCGCACC 175 MR939 Reverse 74716 74809 94 139.1 CGGCGCCGCCGUCGCUGCUGCU CGCAGGGCCGAGCGGCGCUCCA
404 GTCGGGGTGCTCGCGGAAGATGTCGTGCAGGTCGTGCAGCGTGAGGCGCGGGACGCCGTCGCGCTCGGCGCCGTCCGTCCGCGTCTCGCCGCTACCGCTGCCGCCGTCGTCATACTCCAGCCACGTCGAC 89 MR941 Reverse 74842 74971 130 149.3 UGCAGCGUGAGGCGCGGGACGC GCCGUCCGUCCGCGUCUCGCCG
405 GCGGAAGATGTCGTGCAGGTCGTGCAGCGTGAGGCGCGGGACGCCGTCGCGCTCGGCGCCGTCCGTCCGCGTCTCGCCGC 529 MR943 Reverse 74880 74959 80 118.5 UGAGGCGCGGGACGCCGUCGCG CGUCGCGCUCGGCGCCGUCCGU
406 CGTCGGAGGCGGTGGGCAGGATCTGGTGCTCCTCGCACGAGGTGCAGGCGATGCGCGAGACCTGCTCGTTGCCGTAGGGCG 366 MR946 Reverse 75081 75161 81 126.2 GGUGGGCAGGAUCUGGUGCUCC GGCGAUGCGCGAGACCUGCUCG
407 ATCTGGAAGATGGGCGGCTGGTTGGTGGAGAGCTTGAGCAGCTCGGTGCTTTTGCAGAAACCGTAATAAAAGTTGCGATTTTTCATGAT 287 MR947 Reverse 75194 75282 89 131.3 AGCUUGAGCAGCUCGGUGCUUU UAAAAGUUGCGAUUUUUCAUGA
408 GATGAGCTCCTTGTAGCGCTCGAAGGACTCGCTCACGTCGTTGGGGATGTCCATCTCGTCGATCTTGCGCTGCAGGATGGTTACGTC 519 MR952 Reverse 75518 75604 87 119.0 ACUCGCUCACGUCGUUGGGGAU UUGCGCUGCAGGAUGGUUACGU
409 CGGCCGCAAGGACAGGTTCCTCAGCATGGTGCTGCCGCGGCGTCTGCACCTGGAGGCGGCCTTTCTGCCCTACAGCGTCAAGGAGCACGAATGCTGTTGAGGAACAGCGGCGGCTG 256 MR955 Reverse 75797 75912 116 133.1 GGUUCCUCAGCAUGGUGCUGCC CUACAGCGUCAAGGAGCACGAA
410 CCGCTCCGAGGAGCTGCCGTCGGTGGGCGACCGAGTCTTCTACGTGCTGACGGCGCCCGGCGAGGGCCGCTCCTCGTCGGGGGTG 444 MR957 Reverse 76047 76130 84 122.2 UGCCGUCGGUGGGCGACCGAGU ACGGCGCCCGGCGAGGGCCGCU
411 GCGAGTTCGTCAAGGGCGTGACGCGCGACGTGCTGTCGTTGCTCTTCGACGACCGCGAGGTCTCGCAGGCGGCCGTGCGCCTCTCGCGCCTCACGCTCGAGGACGTGCGCGC 131 MR960 Reverse 76312 76423 112 143.2 UCGUCAAGGGCGUGACGCGCGA GCAGGCGGCCGUGCGCCUCUCG
412 GGACTCATTCCTTAGTCTTTACTGCCGCCGCCGGTGCCACCGCTACACGGACCCGTCGTCGGCTTCATCGCCACATACCGTATAAGAGGCCGAGAGTAGGAGAGGAGGCGGAACGGCGGGGCGGCGGTGGTAGCGGCGGCTGGACGGTGGAGGCTCGGGTCATCT 441 MR963 Reverse 76664 76828 165 122.4 UCUUUACUGCCGCCGCCGGUGC AGCGGCGGCUGGACGGUGGAGG
413 CGCTTCGTGCGGGCCTCGGTGCGCGTCTCGGTGCTGTCGGAGCTGCTCAACAAGTGGGTCTCGCAGCGCAAGGCCGTGCGCGAGTGCATGCGCGAGTG 9 MR970 Reverse 77191 77288 98 180.1 UGCGCGUCUCGGUGCUGUCGGA UCUCGCAGCGCAAGGCCGUGCG
414 AGGCCCGCGTGGACCCCCTGACGCGCCTGGTCATCGACCGGCGGATCACCACCTTCGGCTGGTGCTCCGTCAACCGTTACGACTGGCGCCACCAGGGCCGCTCGTCGACCT 589 MR986 Reverse 78881 78991 111 116.3 CACCACCUUCGGCUGGUGCUCC UGCUCCGUCAACCGUUACGACU
415 TCTACGGCTACGGTACGCGGCCCGTGCCCGACCTGCAGTGTGTGTCGATCAGTAACTGGAGCATGGCCAGAAAGATCGGCGAGTACCTGCTGGAGCGCGGCTTCCCCGTCTACGAGGCCCGCGTGGA 539 MR987 Reverse 78979 79105 127 118.1 GUGCCCGACCUGCAGUGUGUGU AAGAUCGGCGAGUACCUGCUGG
416 TCTGTGCCAGGTGGGTCTTCTTCCTCCGGTCGTACGACCACCCGGACGACTCAGCAGGAGAGCACTACCAACGGTACGGA 324 MR1020 Reverse 82587 82666 80 128.9 UGGGUCUUCUUCCUCCGGUCGU GACGACUCAGCAGGAGAGCACU
417 GCTCCACGGCCCGCCGGTCGCGCGTGATCTCGTCCCGCAAGCGGACCCGCAACGCAGCCTCGTTGCTGGACTTGGCCCGCATCGACCATGTGGGCCAAGATCTGGTGCCTGGTAGTCTGCGTTAGCTTGCTGCGGACGCCCTCCTCCGGCGGCGTGTATGGAGC 61 MR1021 Reverse 82707 82870 164 154.7 GCCCGCAUCGACCAUGUGGGCC GCCAAGAUCUGGUGCCUGGUAG
418 CACCATCCAGCAGCTAAATGTCTACCACCACCTGTGTCGGGTGCTCATGAACACCATCAGTCGCCACCTGTACGGGGAGGACGTGGAGGACATCTTCGCGCTCGGGGAAAAGGTG 514 MR1036 Reverse 84219 84333 115 119.2 UAAAUGUCUACCACCACCUGUG UGGAGGACAUCUUCGCGCUCGG
419 ACGTCTTGTTCTTCGTGGACGGCTGCGAGGCGCTGGCCACCTCGCTCATGGCCAAGTTCGCGGCGCTGCAGGAGCAGGGCGT 180 MR1063 Reverse 85812 85893 82 138.4 GCUGCGAGGCGCUGGCCACCUC AGUUCGCGGCGCUGCAGGAGCA
420 CCTTCGGCCGCCGCTACAGCGCTGAGTCCAAGGACGTCGGTGGGGGGCTGGATGGGAAAGGCGACGATCCCCTGGGCGTGAGCGTCGGCGTCACCTCCGCCGCCTCGTCCTCCACCTCGGCCTCCTCCTCGGGCTCCGGCTCGGGCCGTCTGG 130 MR1078 Reverse 87430 87582 153 143.2 AAGGACGUCGGUGGGGGGCUGG GCGUCACCUCCGCCGCCUCGUC
421 GCGTGCGCACCCGCCTGCCCGTCATCCACAAGCTGCCCAAGCGCGAGCCCTGCGTGGTGGTCATGCAGTCGCGCTTTCTCAGCGACGTGGATGTGCTGGGCACCTTCGGCCGCCGC 123 MR1081 Reverse 87569 87684 116 144.2 ACCCGCCUGCCCGUCAUCCACA AGUCGCGCUUUCUCAGCGACGU
422 TGTCGCCCGTTCACCCGCACCATGAGCGGCGAGGAACTCACCGCCGTGGCGCCGGTGGGGCCCGCGGCA 136 MR1106 Reverse 89099 89167 69 142.4 AGCGGCGAGGAACUCACCGCCG CCGUGGCGCCGGUGGGGCCCGC
423 CTTGCGGTTTTTGTCCGCGGTGCGTCAGTACGTCAAACATGACGTGCTGATTTTTTGCTTGGTATAAAATTCCCCAGG 336 MR1108 Reverse 89183 89260 78 128.1 UACGUCAAACAUGACGUGCUGA CGUGCUGAUUUUUUGCUUGGUA
424 GTATAAGGGGCGTTACTAGAGTGGGCGTTCCTAGGTGTGGAATCCAATCACGGTATACGGGGCGTGGTTTCAAGAAGGGGGCGTATCAGTATCCGGGGCTGGGATCCGCCCACTAGGGGGCGTACCTAGGCACCGCTTCTTTTTTAC 100 MR1124 Reverse 90189 90335 147 147.4 GGCGUUCCUAGGUGUGGAAUCC CGUACCUAGGCACCGCUUCUUU
425 GCCCTGCCAGGGGGCGTACCCCAGTAGGGGTACGTAGTTTTCTTACCGGGGTACCCCCCCTACGGGGGC 385 MR1127 Reverse 90379 90447 69 124.9 AGGGGGCGUACCCCAGUAGGGG UUACCGGGGUACCCCCCCUACG
426 GAATTACGTCATTCTAGGGTACGTACCTAGGTTAGGGTCGTATAGTTCCGGTACGGTGTATAGCCCTGCCAGGGGGCGTACCCCAGTAGGGGTACGTAGTTT 10 MR1128 Reverse 90408 90509 102 177.1 UCCGGUACGGUGUAUAGCCCUG UAUAGCCCUGCCAGGGGGCGUA
427 GCGTTGCCCGGCAACAACACCGACGCCGACGCATGCGCAGTTCAACGTGCGCATGCGCGCTTCGCGTTGGCACTGTGCCGCGCATGC 115 MR1134 Reverse 90945 91031 87 145.2 ACCGACGCCGACGCAUGCGCAG GCAUGCGCGCUUCGCGUUGGCA
428 GCATGCGCACGGTCGCCCTGTGGGCCGGGATTTGGGTCGGGGGTCCGGGCCCGGGGTTCGGCCCCCTCCCCCACCGTCCTCCCGACCAGCACCTCGCCTGCGCGTGC 167 MR1137 Reverse 91425 91531 107 139.9 UCCGGGCCCGGGGUUCGGCCCC CGACCAGCACCUCGCCUGCGCG
429 GGTCGCCCTGTGGGCCGGGATTTGGGTCGGGGGTCCGGGCCCGGGGTTCGGCCCCCTCCCCCACCGTCCTCCCGACCAGCACC 492 MR1138 Reverse 91439 91521 83 120.0 UCCGGGCCCGGGGUUCGGCCCC UUCGGCCCCCUCCCCCACCGUC
430 GGACCCGGCACCTCGCCGAGGCTGCTCGACCGGGGGGATGGGACCCTCGGTTCCGTGTCATGACGTCAGCGATCCGGCGAGGACCGGATGCC 333 MR1150 Reverse 92702 92793 92 128.3 UGGGACCCUCGGUUCCGUGUCA GCGAUCCGGCGAGGACCGGAUG
431 GGCAGACGGTCCGGAGGTCGCGGGTGGATCCTGGGACCTCATCGTGTCCCAGGGACCCGGCACCTCGCCGAGGCTGCT 574 MR1151 Reverse 92768 92845 78 116.6 UGGGACCUCAUCGUGUCCCAGG CAGGGACCCGGCACCUCGCCGA
432 CTGAGGGATTGATCGGCGAGGGATCGGATCTGGCACCTCCGACCGTCGAGCCCCGGTAGAGGGACGTCGAGCGACGGCCGGAGGTGGTCTCCCCAGAAACCGAATCCCAAACCGCCAACCCCAG 533 MR1159 Reverse 93207 93330 124 118.3 UGGCACCUCCGACCGUCGAGCC CGUCGAGCGACGGCCGGAGGUG
433 CCTTTTCTGAGGGATTGATCGGCGAGGGATCGGATCTGGCACCTCCGACCGTCGAGCCCCGGTAGAGGG 594 MR1160 Reverse 93268 93336 69 116.0 UGAGGGAUUGAUCGGCGAGGGA UCCGACCGUCGAGCCCCGGUAG
434 TCGCTAGGGGTGTCGATTCGACCTTTCCGTGCCACGGAGCTCGACACGTTACGGGGAGAGGATCAGGAAGACAAATTTGGCGA 226 MR1164 Reverse 93413 93495 83 134.7 AUUCGACCUUUCCGUGCCACGG UACGGGGAGAGGAUCAGGAAGA
435 GGAATGGTGATTTAGAGACGACAGGTTAAAGAGTTGTTGCTAAGTGATATTTGATGGTTTTGTAATGGTTCTTGCTTTTCGGTTATATCTAGATACAGTTCT 288 MR1202 Reverse 96284 96385 102 131.1 AGGUUAAAGAGUUGUUGCUAAG UUUGUAAUGGUUCUUGCUUUUC
436 CGACGGTCGAAAGCGACGGAGGAGACGGAGGGGAGATGGTACCGACGGCGACGATCCTCCGACCGTTGTTGTGTTTTCTGCGTTCGCTTTTCTAGTCTCTTTTTCGCTTAGACCGCG 30 MR1217 Reverse 97446 97562 117 165.4 GAAAGCGACGGAGGAGACGGAG UCGCUUUUCUAGUCUCUUUUUC
437 CTTCTCGTTCTCGCGCCGTCGTCTCTCTCCGTGGTCGCCCGCGGTAGAGACAGCCGCCACCGATGGCGGCTCGCGGGTGAGAAGCGGCGGCAACGACGACGGTCGAAAGCGACGGAG 247 MR1219 Reverse 97542 97658 117 133.7 GCCGCCACCGAUGGCGGCUCGC CAACGACGACGGUCGAAAGCGA
438 ATCTCTTATCGATCTTGCCGATTTTTTTATTGCGTTCTTGGTTCCCAGGGCGGGATAACAGTAGTAGTCGTCTGTAAGCGAT 473 MR1228 Reverse 98143 98224 82 121.1 UCUUGCCGAUUUUUUUAUUGCG CGGGAUAACAGUAGUAGUCGUC
439 GACCTTCGGCAACCCCGTGCACCGGGCCATGGCCTACGTGTGCTCCTTTTCGCGGGTGGCCGTGGCGCTGCGCCGCCGGGCGCTGCAGGTC 165 MR1244 Reverse 99712 99802 91 140.0 UGCACCGGGCCAUGGCCUACGU CGGGUGGCCGUGGCGCUGCGCC
440 CAGGCGCGGCTCCACAAAGGCGGTGGCTGCTGCGGCGGCGGCGGCGACAGCTCGTCGTCGGGCACCTCGCCCAGCTCCACCTCGCCGGCCTACGACCTGCAGCGGTACACGGCCGAGAGCCTGCGCCTG 297 MR1249 Reverse 100288 100416 129 130.1 UGCUGCGGCGGCGGCGGCGACA CGGCCUACGACCUGCAGCGGUA
441 TGCACGGACTCGCGGCGGGTGGCGCCGGTGTTCGCGGTCGACAACGACGTGCTCAATCTCTCCCGTTACCTGACCGCGCGGCA 334 MR1292 Reverse 104002 104084 83 128.1 GCGGUCGACAACGACGUGCUCA CUCCCGUUACCUGACCGCGCGG
442 CGTGGACAGGGTCGTGATCTCGCCCAGCGTGTCGGGGGGCCGCGTCACGCCCGTGTTCTCG 602 MR1307 Reverse 104927 104987 61 115.7 ACAGGGUCGUGAUCUCGCCCAG GGGGGCCGCGUCACGCCCGUGU
443 GCTACTGCGGTGGTGGCGGCGGTGGGATCGCCCCTGGGGCTGCTCGCGCACGGGCGGGCCGTCCTCGAAGCGCTCCCGTTCCCGCTCCTGCAGCAGC 183 MR1309 Reverse 105113 105209 97 137.9 CUGCUCGCGCACGGGCGGGCCG GGCCGUCCUCGAAGCGCUCCCG
444 GCCTCAGGAGGCTCAAAACCTCGCGCTCGCCGCTGCTACTGCGGTGGTGGCGGCGGTGGGATCGCCCCTGGGGC 609 MR1311 Reverse 105170 105243 74 115.6 GCCGCUGCUACUGCGGUGGUGG UGGUGGCGGCGGUGGGAUCGCC
445 GTTGTAGTGGTCGTCGTCGTTGTGCTGCTTGTAGACTTTGTACTCGAAGGTGAAGTCGAAGTCATATTGGTAGCCACCGTACTCACCACCAGGATCAAT 268 MR1324 Reverse 106772 106870 99 132.2 UGUGCUGCUUGUAGACUUUGUA UCGAAGUCAUAUUGGUAGCCAC
446 GGGCGCTGTCAGAGCCCGCTTGACCGCAGCGCGGTAGAGCTGGCCTTCGGGTACGGACTGACGCTGCTGTCGGCGGGGTCACCGCAGCGCGCC 127 MR1356 Reverse 110148 110240 93 144.0 CGCUUGACCGCAGCGCGGUAGA GGACUGACGCUGCUGUCGGCGG
447 TGCCGGCGCACGGACTGGACGTCGGCGTCCGACTGCGTGGTCTTGAACTCGATCACGTAGCAGACGGCGTGCGGCGGTTTGGGTTTCGCCGGCG 22 MR1369 Reverse 111751 111844 94 169.4 GACGUCGGCGUCCGACUGCGUG GUAGCAGACGGCGUGCGGCGGU
448 TCCGGGGGGTCGCGGCCGTCCCAGAGCGCGTGCCCGTAGGCGGCCAGCAGGCACATGGCGGCCTCCAGATCGGAGAGCACGCAGTCGTAGGCCGGGTAGACGGTCACGCTCTCTAGGGCGTTGACCACCCCCAGCAGGA 448 MR1385 Reverse 112811 112949 139 122.1 CGCGGCCGUCCCAGAGCGCGUG AGAGCACGCAGUCGUAGGCCGG
449 GGGCCCTCCCAGGCGGCGATCTCGCGGCTGACGTCGTCGGCCAGCCGCGGGAGCAGCTGGGGCAGCTC 428 MR1388 Reverse 112972 113039 68 123.1 UCCCAGGCGGCGAUCUCGCGGC CCGCGGGAGCAGCUGGGGCAGC
450 TCGCGCGGACAGCCGCTGCACTCGCTGCGCCTGGAAGAGCTCAAGATCCTGCGGCTCATCTGCGTGATGCTCTTCCACCGCGGCCTGGAGACGCTGCTCCTGCGCGA 195 MR1431 Reverse 116120 116226 107 136.9 CCUGGAAGAGCUCAAGAUCCUG CGUGAUGCUCUUCCACCGCGGC
451 GTCGTCGCGGTCGGCGGCCGTCAGGTCTGGAAACCGCTGCAGCACCCAGTCGGGGTCGCGGCCGTAGACGGCCAGCGTGCCGCGGCGGC 191 MR1441 Reverse 116899 116987 89 137.1 GGCGGCCGUCAGGUCUGGAAAC GUAGACGGCCAGCGUGCCGCGG
452 GCTGTCGGAGCGAAAGGGGTCTCCCGCCGGCGCGCCGCCGCAGCCGCGCCACTGCGCGCGCAGGTCGTCGCGGTCGGCGGCCGTCAGGTCTGGAAACCGCTGCAGCACCCAGT 458 MR1442 Reverse 116938 117050 113 121.7 UCUCCCGCCGGCGCGCCGCCGC CGUCGCGGUCGGCGGCCGUCAG
453 GACTCGCGCTCCGTCACGCCGACCAGCTGCTTGTCGTAGCGCAGCTTGGGCAGGCGCTCGCGAATGTAGAGCGCGTCCACGCTGTTGCCCAGCAGGCCGTAGCTGTCGGAGCGAAAGGGGTC 604 MR1444 Reverse 117030 117151 122 115.6 CGUAGCGCAGCUUGGGCAGGCG CGCGUCCACGCUGUUGCCCAGC
454 TCTCCACCGCCTCGGGCGGCGGCAGCGACGGCGGGTTAGGCTTGGAGGGAGCCGGCGCGCTGCGGCGTGGCGGTGGAAGA 540 MR1445 Reverse 117257 117336 80 118.1 CGGCAGCGACGGCGGGUUAGGC GCCGGCGCGCUGCGGCGUGGCG
455 CCGCTCCCACGTCGACGGCGCATCGTCCATCATGTCGCGTCTACGGTGATGATGGTGGTGCTGCTGCTGAGGTGGCGGCGG 160 MR1454 Reverse 117780 117860 81 140.3 ACGGCGCAUCGUCCAUCAUGUC GAUGAUGGUGGUGCUGCUGCUG
456 CGCCGCCACCATGCTGCTGGGACGGCGGCGGCGGAGGAGCTCCGTCGTAAGGGTACCGCTCCCACGTCGACGGCGCATCGTCCATCATGTCGCGTCTACGGTGATGATGGTGGTG 532 MR1455 Reverse 117801 117915 115 118.3 CGGCGGCGGAGGAGCUCCGUCG UCGCGUCUACGGUGAUGAUGGU
457 GGGGTGGCGTCGCCGGTGATCATGGGCGTCTCGGCGGGGCTGGAGGCGGTCGTGGTCGTGGGCGACGGCGCCGCC 91 MR1461 Reverse 118214 118288 75 149.0 GCGUCGCCGGUGAUCAUGGGCG AGGCGGUCGUGGUCGUGGGCGA
458 ACCGCGTGATCCACCCGACACGAGGCATTGACCACCCCGGCGACGGCGGCGGCCGCGCGCTCGGCGGCCCCGACTTTGCCGGCGGGCGTCGTCTGCGGCGGTGGGGTGGCGTCGCCGGT 49 MR1462 Reverse 118272 118390 119 157.6 ACCACCCCGGCGACGGCGGCGG CGGCCCCGACUUUGCCGGCGGG
459 TGACCACCCCGGCGACGGCGGCGGCCGCGCGCTCGGCGGCCCCGACTTTGCCGGCGGGCGTCGTCTGCGGCGGTGGGGTGGCG 114 MR1463 Reverse 118280 118362 83 145.2 ACGGCGGCGGCCGCGCGCUCGG CGGCGGGCGUCGUCUGCGGCGG
460 GCCGACGGTTCAAGTCCACCATGTCCTTGGGCGGGTTCTGCAGGGCCAACGCGGCGGCGGGCAGGCCGGCGGCGGTGGTAGTGCTGCTGCTACCGCCGCTGGTGCCGGCTACCGCGTGATCCACCCGACACGAGGCATTGACCACCCCGGC 63 MR1465 Reverse 118350 118500 151 154.6 CACCAUGUCCUUGGGCGGGUUC UACCGCCGCUGGUGCCGGCUAC
461 CATGCTGTCTGATGTGCGTGTATGTATGTCTGTGTGTCTGTCTCTGAAAAGCCACTGCTGTGATCATGGTACGTTATATATACAACCAGTCTGCATG 490 MR1468 Reverse 118669 118765 97 120.1 UAUGUAUGUCUGUGUGUCUGUC CAUGGUACGUUAUAUAUACAAC
462 TCAGGTGAAGTCGGCGCTGCACAACCGACCGGCCCCGCAGCTGTCGGTGCTGGGCGCCTCGATCGCGCTCCAGGACCTGCTGCCCATGCGGCTGTTGAGCGCCGAGCCGACGCAGGA 527 MR1509 Reverse 122742 122858 117 118.6 CCCCGCAGCUGUCGGUGCUGGG CUCCAGGACCUGCUGCCCAUGC
463 GGCCGCGGCGCTGGGGCCGTCGGTGTTCGGACGGCTGGAACTGGACGCCGAGTCGCCCGCGGACCTGACGCTGTCGTCGCTCACGCTGTACCAGGACTGCGTCCTGCGTTTCAACGTGACGTGCGACCGCAGCGAGGGTCCCAGCGACCCGGTGTCGTTCCGCCTGCGACTGCGCCGCGAGACGGTGCGCCGGCC 143 MR1517 Reverse 123291 123485 195 141.7 UACCAGGACUGCGUCCUGCGUU UGCGCCGCGAGACGGUGCGCCG
464 GTGGAGGGCGGCATCTCGGGTCCGCGCGGCCTGACTAGCCGCCTGTCGGTGCGGCTGTCGGAGGCCACGGCCGCGGCGCTGGGGCCGTCGGTGTTCGGACGGCTGGAACTGGACGCCGAGTCGCCCGCGGACCTGACGCTGTCGTCGCTCACGC 106 MR1518 Reverse 123400 123553 154 146.5 UGCGGCUGUCGGAGGCCACGGC UCGGUGUUCGGACGGCUGGAAC
465 GCCGGCGACGGACACGGAGCTGACGCCCAGCCTGACGGTGCAGGTGCGGCACGCGCTGTGCTGGCACCGGGTGGAGGGCGGCATCTCGGGTCCGCGCGGC 326 MR1519 Reverse 123524 123623 100 128.7 CAGGUGCGGCACGCGCUGUGCU GCGGCAUCUCGGGUCCGCGCGG
466 CGTGGTGGGCGAGATCATCCCGCTGCAGCAGCACATGTTATTTAACTCGTGAAGCGCGGACTGCGACGAGCGCGGACGAACAGCGTGGGCCGCGTGTCGCTCTGTGGCCGGACCCACCGCCGCGTCCGCGAACGACGCGGCTCGCCTGACGGAGCGCCGTGCTGCGCGGACGTTGATCTCGCCCCCGTG 274 MR1543 Reverse 125378 125566 189 131.9 AUCAUCCCGCUGCAGCAGCACA CGGACGUUGAUCUCGCCCCCGU
467 GCAGGACCTGTTCGCCGTCTTCCCCATGCACGTGTACCGGCACGACGAGATCGACCGCTGGATCCGGCACGCCGTGGGGGTGGCGCGGCCACAGCTGC 309 MR1553 Reverse 126201 126298 98 129.4 UUCCCCAUGCACGUGUACCGGC CGCUGGAUCCGGCACGCCGUGG
468 GTCGAACACGTGCGTGGCCTACGTGAACCGGGTGCGCACCGACATGGGCGTGCGCGTGCAGGACCTGTTCGCCGTCTTCCCCATGCACGTGTACCGGC 192 MR1554 Reverse 126258 126355 98 137.1 UACGUGAACCGGGUGCGCACCG CGCGUGCAGGACCUGUUCGCCG
469 GCCACGGACGCGCACGTCTCACTGACGCAGGCCTGCCGCGAGCTGTTCCTGGCGGTGCAGTTCGTGGGCGAGCACGCGAAGGTGCTGGAGGTGCGCGCGGAGC 27 MR1561 Reverse 126933 127035 103 166.9 AGCUGUUCCUGGCGGUGCAGUU UGCAGUUCGUGGGCGAGCACGC
470 GCCAGCGCGACGGGCACCGCGGCGGCGTCGTCGGGCACCGCCACGTCGGGCAGCGGCAGCGGGGCGGCCGGCGACGACGGCGCGGGTTCCGCGGCGGC 53 MR1563 Reverse 127085 127182 98 156.6 GCGUCGUCGGGCACCGCCACGU AGCGGGGCGGCCGGCGACGACG
471 GCTCGGGCGCCAAGATCAGCGGCGTGATGGTGAGCACGGCCAACGTGATGCAGATCATCATGTCGCTGCTCTCGGGCCTCATCAGC 298 MR1581 Reverse 128800 128885 86 130.1 CAAGAUCAGCGGCGUGAUGGUG UGCAGAUCAUCAUGUCGCUGCU
472 CGACTATTAGAGCGTCGCGGCCGGCGCGGCGCGGCGGAGCAGCCATCGTCGGGCCCGCCGTGCCAGCGCCGCCGCGATGGAGAACTGGTCG 67 MR1592 Reverse 129661 129751 91 153.5 CGCGGCCGGCGCGGCGCGGCGG CCGCCGUGCCAGCGCCGCCGCG
473 GCGCGCCGCCGCCGGCGCAGCGGCAGCGACGGTGCACGTAGAGCAGCGGCCCGCGGCAGAACTGCGCCGTCTCGGCCAGGTGTTCGCGCAGCAGGCGCGC 171 MR1598 Reverse 130048 130147 100 139.7 AGCGGCCCGCGGCAGAACUGCG AGAACUGCGCCGUCUCGGCCAG
474 GTGGAGGCCGCTGGCGTGCGCGTGTTTGTACTTGCCGTAGCTGACCTGCAGCTTGAAGTACAGCACCTGGCGCTTGAAGCGGCTGAGCAC 269 MR1604 Reverse 130693 130782 90 132.2 UGCGCGUGUUUGUACUUGCCGU AAGUACAGCACCUGGCGCUUGA
475 CGCCGCCGCTTCCATCATCTTCTGGTGTCGACCGGAGAAGACGGCGGCACCGAGGGCGGTGGTGGCGGTGACG 79 MR1627 Reverse 132668 132740 73 150.6 UCCAUCAUCUUCUGGUGUCGAC GGCACCGAGGGCGGUGGUGGCG
476 TGTAGTTCCTGAGAGCCGACGCGAAAGCGCGGACCGCCGCGCTGTGCCGGCGGACCGTGCTGATCTCCACGTCCGGCGCCCAGAGCACA 398 MR1634 Reverse 133475 133563 89 124.3 CGCCGCGCUGUGCCGGCGGACC GGACCGUGCUGAUCUCCACGUC
477 GGGTCAGCTAGGCGCGCAGGACGGCCACCAGGTCCTGGATGGACACCTCCGCGTCCAGGGCGCCCAGGCGGTCGAAACCCAGGCGTGTGTAACTGCCC 396 MR1641 Reverse 134177 134274 98 124.4 UGGAUGGACACCUCCGCGUCCA UCCAGGGCGCCCAGGCGGUCGA
478 CCGACGGTTCCCGCGGGCGCCAAATCGCGCCGGGTGATTGGTTCCCGCCCGCCTCGGCACGGTTTGGCGCCCGCGGGCGATAACCGCCGCGG 112 MR1655 Reverse 135506 135597 92 145.5 CGCGGGCGCCAAAUCGCGCCGG CGCCUCGGCACGGUUUGGCGCC
479 GCGGCCGTGGCCGAGGCCGGCACAAAGACGGGGGAGTCACAAGAGAGCTTGGAGGAGCTGACGACGGAAGGGCTGACGTTCCCGGTGCTCATGGGCACGGGAGCGTTCGTCGCCGCGCCTCCCTCCGCCGCTGCTCCTCCTCCCGCAGCGCCACTGCCGC 584 MR1663 Reverse 135917 136076 160 116.5 CGGGGGAGUCACAAGAGAGCUU GGGAGCGUUCGUCGCCGCGCCU
480 CAGCGTGGAGATGAGCGCGCAGCCGCTGCCCAGGTCGCACAGGTGCGTGCGGAAGCACCGCGTGCAGGCGTACAGCGAGTGCAGCTGGATCTCCTCGGTG 534 MR1665 Reverse 136130 136229 100 118.3 UGCGGAAGCACCGCGUGCAGGC ACCGCGUGCAGGCGUACAGCGA
481 GCTGTAGACGCCGCTGAGAACCGCGCCGATGATGTTGACGTCGTCGAGCGACGTCTCCTCGATGGGCTCCAGC 561 MR1667 Reverse 136301 136373 73 117.3 CGAUGAUGUUGACGUCGUCGAG UCGAGCGACGUCUCCUCGAUGG
482 CGGTCGCGCTCCACCACCTCCTGAATCACGTCGGCGTAGCGGCCGGCGTGCGTCATGAGGTAGCTGTAGACGCCGCTG 414 MR1668 Reverse 136358 136435 78 123.6 CCACCACCUCCUGAAUCACGUC GGCGUGCGUCAUGAGGUAGCUG
483 GCTCGGTGCTCTGCGGCGGCGGCGCGGGTCGCACGGCGTTGCGGTAGTAGACGTAGCGCAGCGTCTCGGCCTCCTCGCACGAGAGTGCCGAGT 84 MR1674 Reverse 136739 136831 93 150.1 UGCUCUGCGGCGGCGGCGCGGG UAGCGCAGCGUCUCGGCCUCCU
484 GCGCCACCCGCAGCTCCAGGTCGCTGGGGCCCCCGCTCTGCCCGCTGCCGCCGTCGGCCCCGGCCGGTGCGCGGGGGATCTGAAAGAAGGGCGTCCCGGCCGCCGACTCCAGCGGGGGCAGC 573 MR1682 Reverse 137328 137449 122 116.7 CGUCGGCCCCGGCCGGUGCGCG UGAAAGAAGGGCGUCCCGGCCG
485 GCGCGGGCCAGCTCCCGCTGCAGCTCCTGACGCTCGTCGCCCAGCAGGTGGGCGCCCACGCGCTGCACGGTCAGGCGGCTGTAGTGCGTCTGCTCGCGC 119 MR1740 Reverse 142053 142151 99 144.5 CUGCAGCUCCUGACGCUCGUCG CGGCUGUAGUGCGUCUGCUCGC
486 GTCCGTGGTAGCTGCTGCCGCCGTCGCTGCTGACGGCGCTGCGCCGACCGCTGAGGCCGCGGTTCTCCTTGTTGCTGTCGGCGGGCAGCGGCGTGGGAGGCGGGGAGGCGGGGGCGGCCACGGCGGGC 223 MR1752 Reverse 142724 142851 128 135.1 GGUAGCUGCUGCCGCCGUCGCU UUGCUGUCGGCGGGCAGCGGCG
487 GCTGCGCCGACCGCTGAGGCCGCGGTTCTCCTTGTTGCTGTCGGCGGGCAGCGGCGTGGGAGGCGGGGAGGCGGGGGCGGC 361 MR1753 Reverse 142734 142814 81 126.5 CUGUCGGCGGGCAGCGGCGUGG AGCGGCGUGGGAGGCGGGGAGG
488 CGCGGCAGCGGAGTCCGTGGTAGCTGCTGCCGCCGTCGCTGCTGACGGCGCTGCGCCGACCGCTGAGGCCGCGGTTCTCCTTGTTGCTGTCG 411 MR1754 Reverse 142772 142863 92 123.9 CGCCGUCGCUGCUGACGGCGCU CGCGGUUCUCCUUGUUGCUGUC
489 GAGGTCCGTGTGGAAGCGCCGGTGCACCGTGACGTTGTGCAGCAGGCAGCAGCCGGTGGCCGTCAGCAGTCCGCGGTAGACGCCCGTGCCCGCCAGCGATGGCGGCTGCTGCTCGTCGCCGGCGGCGCGCGTGCGGATCAGGCCCGACATCCAGACGGTTAGCACCGTCTCGCTGTGCTTGCGCGCGATCTTGAGCACGCGCTGGCGGTCGAGCGGCCAGACCTC 569 MR1762 Reverse 143589 143813 225 116.8 AGCAGGCAGCAGCCGGUGGCCG CUCGCUGUGCUUGCGCGCGAUC
490 TCGCCGGCGGCGCGCGTGCGGATCAGGCCCGACATCCAGACGGTTAGCACCGTCTCGCTGTGCTTGCGCGCGATCTTGAGCACGCGCTGGCGGTCGA 451 MR1763 Reverse 143602 143698 97 122.0 CAGACGGUUAGCACCGUCUCGC CGUCUCGCUGUGCUUGCGCGCG
491 GGCGCGGCGGTAGCTGTCGACGCACGCCAGCTTCCAGTGGTCGTGGTGGAAGAGGTCCGTGTGGAAGCGCCGGTGCACC 520 MR1765 Reverse 143786 143864 79 119.0 UGUCGACGCACGCCAGCUUCCA AAGAGGUCCGUGUGGAAGCGCC
492 GTGCCCGTCTCCTGGAATACGGCCACGCAGCGGTCGTTGCAGTCCGGGTAGGGCTCGCTGAGGCTGTAGTCGCAGAGGGCGGCGCGC 109 MR1768 Reverse 143984 144070 87 146.1 AAUACGGCCACGCAGCGGUCGU AGGGCUCGCUGAGGCUGUAGUC
493 GCTCGCCCAGCAGACAGGCGTGGTAGCTGATCTGCGCGCCCATGATGAGCAGGCAGGCGTCGGCGCACTGCTGCAGCTTGCCGTTCTCCAGCGCGCGGCAGGCGGCGCCGGCGTGCTTGAAGAGC 182 MR1775 Reverse 144308 144432 125 138.1 GCAGGCAGGCGUCGGCGCACUG AGCUUGCCGUUCUCCAGCGCGC
494 GAACCGCAGCGCGTGCGGCAGCAGCGAGTCGCCGTGCTCGCCCAGCAGACAGGCGTGGTAGCTGATCTGCGCGCCCATGATGAGCAGGCAGGCGTCGGCGCACTGCTGCAGCTTGCCGTTC 603 MR1776 Reverse 144347 144467 121 115.6 GUAGCUGAUCUGCGCGCCCAUG CGCGCCCAUGAUGAGCAGGCAG
495 GCGCGAGGCCTCGGTGGCATGCCGCTGGCTCAGGATGTCGCGCAGCCCTTCGTCGCGAGCCAGCGCGGCGACGCGCGACATGAACTCCTCGGCCACCGGCATGCCGTGGGCCCGCAGC 70 MR1785 Reverse 145044 145161 118 152.3 CCGCUGGCUCAGGAUGUCGCGC CGACGCGCGACAUGAACUCCUC
496 GTAGTCGCGCAGGGGCTCGGGCGCCTTGAGCGGCCGCGCGCGCTTGAGCGTGGCCTTGAAGAGCTCCGCGTCGTGCGAGAGCAGGAACTCGCGGGCCGAGGGCACCTCGCGCTCGGCGCGGAACTCCACGCCCGGCACCGGGTGCGACTGC 178 MR1794 Reverse 145764 145914 151 138.8 GGCCGCGCGCGCUUGAGCGUGG ACUCGCGGGCCGAGGGCACCUC
497 GGTCAAAGACCACGGGGGTGACGATGATGAGCAGGGGGATGTGGTCGCAGTTGAAGGGCCGTCCGCCGGCCAGCAACTCGCGGCCCACCTCGCTCTCCTCGCGCTCGCGGAAAATGGCC 113 MR1803 Reverse 146289 146407 119 145.4 GGGGGUGACGAUGAUGAGCAGG AGCAACUCGCGGCCCACCUCGC
498 CGCCGTCGTCTGGCTTCCTCCTCTGGGCGGGAGGGGCGGAGGCGAGGACGAGGCG 546 MR1812 Reverse 146993 147047 55 117.9 CGUCUGGCUUCCUCCUCUGGGC GGGGCGGAGGCGAGGACGAGGC
499 CGCCGACGCTGTTTCTGGACTCGGTGCAGCTGGTGTGCTACGCGGTTTTTATGCAGCTGGTGTTCCTGGCGGTGACGGTGTACTACCTGGTGTGCTGGGTAAAGATAGCGTGGCGCCGGGACCAGAGCACGGTCCTGAACCAGTCGACGCGCG 338 MR1826 Reverse 148220 148372 153 128.0 CUGGUGUGCUACGCGGUUUUUA UGGUGUGCUGGGUAAAGAUAGC
500 TACGCCGACGCTGTTTCTGGACTCGGTGCAGCTGGTGTGCTACGCGGTTTTTATGCAGCTGGTGTTCCTGGCGGTGACGGTGTA 526 MR1829 Reverse 148291 148374 84 118.7 UCGGUGCAGCUGGUGUGCUACG GCUGGUGUUCCUGGCGGUGACG
501 GCTGTGAGGGCCCGACGGGCGCCGCGCGGTCTTTTGGCCGGTCGCGTCGACGCGTTCAAACCGCGTCCTCGGGGAAGGCGCGGGAGGAGGCGCAGCCGCGGCATGGGCCTCCATAGT 349 MR1832 Reverse 148651 148767 117 126.9 UCGACGCGUUCAAACCGCGUCC CGUCCUCGGGGAAGGCGCGGGA
502 GTGGCGTCGCGCACGTGCACGGTGAAGGTGGCGTCGTCGTGCGGCGGGTGCGCGCCGC 242 MR1845 Reverse 150143 150200 58 133.9 UCGCGCACGUGCACGGUGAAGG GUCGUGCGGCGGGUGCGCGCCG
503 GCACGCACTCGACCAGGTCGACGATGACCACCCGGTGCAGCGTGGCGTCGCGCACGTGCACGGTGAAGGTGGCGTCGTCGTGCGGCGGGTGCGCGC 150 MR1846 Reverse 150146 150241 96 141.2 ACGAUGACCACCCGGUGCAGCG CGUCGUCGUGCGGCGGGUGCGC
504 CCGGCGACTGATCTGCAGCGCCCTGTACCTGTTCTTCGAGGAGAAGGACGCGGACGTGGTGGAACACGTGCCGG 413 MR1866 Reverse 151962 152035 74 123.6 CUGUUCUUCGAGGAGAAGGACG AGGACGCGGACGUGGUGGAACA
505 GCGGCGTGGTGGGCCCCGGCCCGGGCCCCGGCGGCGGAGGAGGCCTGGGGGCCGCCTCGTCGGTCTCGGGCGGCCTGGGCCAGGAGCGCGACATCCGCG 81 MR1879 Reverse 153166 153260 95 150.2 CCGGCCCGGGCCCCGGCGGCGG CGCCUCGUCGGUCUCGGGCGGC
506 CGCCCGGCGGCGTGGTGGGCCCCGGCCCGGGCCCCGGCGGCGGAGGAGGCCTGGGGGCCGCCTCGTCGGTCTCGGGCG 496 MR1880 Reverse 153193 153270 78 119.9 CCGGCGGCGGAGGAGGCCUGGG AGGAGGCCUGGGGGCCGCCUCG
507 GGCGGCAGCGGCGACCGAGGACGCGACAGAGGTCGGGCGAGGGACAGAAGAAGTAGAGGGTTCGCTCTTGCCTACTCTTCCCGCGTCGGCCCCGGACGCCGTGCCGCC 208 MR1897 Reverse 154452 154559 108 136.0 ACAGAGGUCGGGCGAGGGACAG CGCUCUUGCCUACUCUUCCCGC
508 CGCAGTTGAGGTTGGCCGCCAGCACCTGGATGCTGGAGGTCTTGCCGGCGCCGGCGGTGCCGGTGACCAACAGCGTGCGGAAGGGGAAGAAGGGCCAGCGGTCGACGCG 415 MR1899 Reverse 154587 154695 109 123.5 UGCCGGCGCCGGCGGUGCCGGU CGGUGACCAACAGCGUGCGGAA
509 GCAGGGGATGTCGTGGGTCTCCTCCGCCTCGCCACCGTCGTCGGAATCGTCCGAGACGACGGGGTTTCTGACGGGCGAGAAGGAGACGCGGGCACTGC 176 MR1920 Reverse 156262 156359 98 139.1 CUCCUCCGCCUCGCCACCGUCG CGAGAAGGAGACGCGGGCACUG
510 ATCATTGTTTTTGATGGTATATTTTGTCGAGATAGTAGCCAGGTTATAAGGATCATATATATCGTCAGGAAACCTAATGAT 409 MR1938 Reverse 158489 158569 81 124.0 UUUUUGAUGGUAUAUUUUGUCG AUAAGGAUCAUAUAUAUCGUCA
511 GTCCGTCTCCTCGCCTCTCCTCCCACATCATCCTCTGCCGTGCCGTCGCGCCTTCGGCGTTCTGCGGTGTGCGCGGGTTTCGTCACCGGGGAACGCGAACGCGAGCCGCAGAGAGCCACGACGACGAGGAAGAGGAGGACGACGAC 253 MR1959 Reverse 160515 160660 146 133.2 UUCGGCGUUCUGCGGUGUGCGC CGGGGAACGCGAACGCGAGCCG
512 TCCTCTGCCGTGCCGTCGCGCCTTCGGCGTTCTGCGGTGTGCGCGGGTTTCGTCACCGGGGAACGCGAACGCGAGCCGCAGAGAGCCACGACGACGAGGAAGAGGA 139 MR1960 Reverse 160525 160630 106 142.0 UCUGCGGUGUGCGCGGGUUUCG AACGCGAACGCGAGCCGCAGAG
513 TGCGGAGCGGGCGCGGCGCTCGTCGGAGGCTGTCGAGCGAGTGCCACCGCAGCCGGCAGAGCGCTGAAGCCCGTCGCA 218 MR1986 Reverse 162732 162809 78 135.3 CGCGGCGCUCGUCGGAGGCUGU CGCAGCCGGCAGAGCGCUGAAG
514 CTCTTCACGTAGTGCCGCACGTAGGTGACCTGCAGACTGCCGTTCTCGCAGATCATGGTGAGCAGCGCGCTCTCGTTGGGGCCACCCGTGCCCACCACTGAGGAG 319 MR1992 Reverse 163139 163243 105 129.0 UGACCUGCAGACUGCCGUUCUC CCACCCGUGCCCACCACUGAGG
515 CCACGGCTTCGGACGTGACGCCGCCGTCCAGGGGCAGCATGCGGTTGAGGCCGGCGGTGGTGGCGCCGCTACCGTTGTTGCCGCCGCCGTGAGCGCCGCTGTTGCCGCCGGCGCCGCTCATCCCGACGCAGG 164 MR2005 Reverse 163891 164022 132 140.3 CCGCCGUCCAGGGGCAGCAUGC UUGCCGCCGCCGUGAGCGCCGC
516 GACCGTTGTCGTTGGGGTTACCGTCGCTGGAGGTCGCTGTGGCGGTAGGAGCTGTCGCCGGGACGCGTGGCGGCTGTGACTGCTGCTGCTGTTGTTGTGGCTGCTGCTGCGGTGGCTGTCCAGGAGCGGCGGTC 72 MR2013 Reverse 164441 164574 134 151.9 UACCGUCGCUGGAGGUCGCUGU UGUGACUGCUGCUGCUGUUGUU
517 CTGGAGGTCGCTGTGGCGGTAGGAGCTGTCGCCGGGACGCGTGGCGGCTGTGACTGCTGCTGCTGTTGTTGTGGCTGCTGCTGCGGTGGCTGTCCAG 125 MR2015 Reverse 164452 164548 97 144.2 UGGCGGCUGUGACUGCUGCUGC UGCUGCUGUUGUUGUGGCUGCU
518 CGGCTGCGGCGGCGGCAGCGGCGACCGTGACGGCCGCGGCCGCGGTGGCGCTGCTAGCACCAGCGGCGGTGTGGTGGTGCTGGCGACCGTTGTCGTTGGGGTTACCGTCGCTGGAGGTCGCTGTGGCGGTAGGAGCTGTCGCCGGGACGCGTGGCGGCTGTGACTGCTGCTGCTGTTGTTGTGGCTG 42 MR2016 Reverse 164472 164658 187 159.1 GGCCGCGGCCGCGGUGGCGCUG UGGCGGCUGUGACUGCUGCUGC
519 GCGGAGGCGACGGTGACGGCTGCGGCGGCGGCAGCGGCGACCGTGACGGCCGCGGCCGCGGTGGCGCTGCTAGCACCAGCGGCGGTGTGGTGGTGCTGGCGACCGTTGTCGTTGGGGTTACCGTCGCTGGAGGTCGCTGTGGCGGTAGGAGCTGTCGCCGGGACGC 55 MR2017 Reverse 164509 164674 166 156.5 UGCGGCGGCGGCAGCGGCGACC UGCUGGCGACCGUUGUCGUUGG
520 GGATACGGGCCCGAGTTCAGTCATCAAAGAAGGCCGCGATGGAAGCCGCGGCGATCGCGGCCTCCTCGCTGGGATCGATGATCTCCAGTCCGTCCTCC 416 MR2026 Reverse 165149 165246 98 123.4 AGUCAUCAAAGAAGGCCGCGAU UCGAUGAUCUCCAGUCCGUCCU
521 CGCATGGTGCCAGCGCGGCGTGCTGCTGCTCAACACCGTGTTCACCGTGGTGCACGGACAGCCTGGATCTCACCGTCACTTAGGCTGGCAGACGCTGAGTGGCCGTGTGATCCGTAGGCTGTCAGAGCTCCGAGAGCATCTGGTGTTCATGCTGTGGGGCGCCGAGGCGCAGAGCTGCG 21 MR2036 Reverse 165667 165845 179 169.7 UGCUGCUGCUCAACACCGUGUU AGUGGCCGUGUGAUCCGUAGGC
522 CTGGGGATGCCTGGACGCATGGTGCCAGCGCGGCGTGCTGCTGCTCAACACCGTGTTCACCGTGGTGCACGGACAGCCTGG 408 MR2037 Reverse 165780 165860 81 124.0 GACGCAUGGUGCCAGCGCGGCG CAACACCGUGUUCACCGUGGUG
523 GGGTGCGCTTCCTCAGCCTGCCCGAGCACGACACGGCGCTGCTGCGCGAGACGGTGGCGGCGGTGGAGTCGGCCCGGCAGCGCGGGGTGGTGTACCC 13 MR2044 Reverse 166062 166158 97 174.6 UGCCCGAGCACGACACGGCGCU CGGCGGUGGAGUCGGCCCGGCA
524 GTGCGGCGACGGCTCGCCCTCGATCTACACGTGCGTGGACGACCTGTGCCGCGGCTACGACTTGACGCAGCTCAAGTACGTGCGCACCGTGTTCAGCGAGCACGTCCTGGGC 427 MR2052 Reverse 166527 166638 112 123.1 CACGUGCGUGGACGACCUGUGC AGCUCAAGUACGUGCGCACCGU
525 CATACCGGCGGCGGTGGAGATTCACCTGACCGAGGACGGCCTGCCACCAGGGACCTCCGGCGCCGTCGGCATG 412 MR2079 Reverse 168832 168904 73 123.7 AGGACGGCCUGCCACCAGGGAC CACCAGGGACCUCCGGCGCCGU
526 TCCTGCCCCCCGTCCCCGTCACACGCCGTCATGTCTCCCCTCGTGACGATCTTCGCGATCGCCGCGCTAGTCGGCGACATGACTGGGGCGCGAGGGGACAAGA 189 MR2091 Reverse 170619 170721 103 137.3 CGUCAUGUCUCCCCUCGUGACG CGCGCUAGUCGGCGACAUGACU
527 GTGTCGCAGCTAGTATTCGTGATGCTTATTATTAACGCCTCTTTCGTCTGGAGCTGGAAATTTAGGCGTCATAGGTGACGCGCTGTGTACAT 331 MR2092 Reverse 170728 170819 92 128.5 GUGAUGCUUAUUAUUAACGCCU AGCUGGAAAUUUAGGCGUCAUA
528 CGTCACAGAGTGTTTTACTTTTGTAAACCGAGAGTGACCCGTGTCATGATGGTGGCGTGGTGGTACTTGGTGTGCACGGTGTTATTGTGGATGACG 392 MR2107 Reverse 171881 171976 96 124.6 CGUGUCAUGAUGGUGGCGUGGU UGGUGGUACUUGGUGUGCACGG
529 CTTATTAACCTCGGGGTGGTTCATGCATGTGTCAGGCTGGGGGTGGAGAGACAGCTGTGGAACTTAGTGACTCATGACAGCTATCTCTGTTATCCTCCACAGTTAAGCAGATTAAGGTCCGCGTCGATATTGTGAG 363 MR2152 Reverse 175098 175233 136 126.4 CUGGGGGUGGAGAGACAGCUGU AUGACAGCUAUCUCUGUUAUCC
530 GGCTGTACGCCAATTGCATCATCCTATTGTTTTTCTATGGGAATTTCCCTATTGGCAGTACATCAACGTATTACTAATGGGGATTTCCAATGACTAATACAACGGGCAGTACGCC 406 MR2177 Reverse 176851 176965 115 124.1 UAUGGGAAUUUCCCUAUUGGCA UACUAAUGGGGAUUUCCAAUGA
531 TGAGCCATAGAATGTACTGCCAAGTGGGCCATTTACCGTTCACCACGCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCTGTACGCCAATTGCATCA 597 MR2179 Reverse 176945 177048 104 115.9 GUACUGCCAAGUGGGCCAUUUA AAUGACGGUAAAUGGCCCGCCU
532 CGACCCCCGCCCATTGACGTCAATGGTGGGACTTTCCATTGACGTCAATGGGCGGGGAACG 447 MR2180 Reverse 177053 177113 61 122.1 CCCGCCCAUUGACGUCAAUGGU AUUGACGUCAAUGGGCGGGGAA
533 CCGAGCGGGACGACTTTGCGCGCCCGTGGGACTACTGGGACACGTGTTCCCCGGCGCTGCCGGAGCGTACCCGTCAGG 389 MR2212 Reverse 179658 179735 78 124.8 GACGACUUUGCGCGCCCGUGGG UUCCCCGGCGCUGCCGGAGCGU
534 GTGGTTGTACCGTGTGTTTCTGTCTGTTTTGTGTCTGAGCGTCGCGGTGTGGGGCCAGTGTCGCAGGGAGGAAGCCGAGCGGGACGACTTTGC 453 MR2214 Reverse 179717 179809 93 121.8 UGUCUGAGCGUCGCGGUGUGGG GGAGGAAGCCGAGCGGGACGAC
535 CGCTGCTGATAACGGTGATGGGCATCTTGTGGGTTCGCGTTTTGGTAACCTGGTGGATGTCGTCGCCCCGGTAGCG 469 MR2219 Reverse 180843 180918 76 121.3 AUGGGCAUCUUGUGGGUUCGCG UGGUGGAUGUCGUCGCCCCGGU
536 GGAGGGGGACGACGAAGGCTACGGAGACGACCCCGCCCTGACGCACGAGGATCGCGACTACCGGGCGCTGTGGGCCTTCTCCCTGGTGATCTGCGGTACGCTCCTCGTGACGTGTGTGCTGTAAAGGGAGGGGAAAACGTCATGCCGATAAAGCTGCCGTCTCTCTCC 478 MR2233 Reverse 181864 182031 168 120.9 UGUGGGCCUUCUCCCUGGUGAU AUCUGCGGUACGCUCCUCGUGA
537 GTCCGTCACGAGTTTAACCGCCTCTTCTTCCGCGTCGTGTTCGACGCGGAACAGGAAGTTTATACCGTGATAGAC 211 MR2236 Reverse 182289 182363 75 135.7 AGUUUAACCGCCUCUUCUUCCG CGGAACAGGAAGUUUAUACCGU
538 TTATTTTGATATGTAGGACACTCCATGCACATAGATAATCCGTTATGAAGTTTTTATTATCAATAATAA 419 MR2240 Reverse 182999 183067 69 123.4 UGAUAUGUAGGACACUCCAUGC UAUGAAGUUUUUAUUAUCAAUA
539 GATGGGACCGCTACCATGCGCGGTCGCCGACCCTCCGACGGCGGCGGCAACGGGGGTGCCAGCGGGGTATGAGGCCTCTGTGGACGCTGCTGTGCCTGGGGTCGGCAGTCGCAGCGGCGCGAGTAGCGGGAATC 293 MR2265 Reverse 185019 185152 134 130.7 ACCAUGCGCGGUCGCCGACCCU GAGGCCUCUGUGGACGCUGCUG
540 TCTGAAATATGATGTACATGGCTACTCTTATATAGGTTACGTATATGGTTTTTTGAACGATAGCCTGTTTGTTCGATATAACGGGTCGTATACGTCCAATCTGCGTCAAGAAGCACCACACGTCATCACAGA 196 MR2275 Reverse 186124 186255 132 136.7 CUCUUAUAUAGGUUACGUAUAU UCGUAUACGUCCAAUCUGCGUC
541 CACGGAGCCCCCGCTGGCGACACCGCCCGAGATCCCGACGGGGCTCTCGCCCTGGGCCACTCGGGGCGTGGCGAGCTTTCTGGGTTTCTGGGGTTTTTTCAGCGTGGGGTTCGTGTG 20 MR2284 Reverse 186619 186735 117 169.7 CCCCGCUGGCGACACCGCCCGA UUUUUCAGCGUGGGGUUCGUGU
542 CGGTTGGTCGTCGCAGATGGGGTTCCGGCGCAACCGGTTCTACATCGAGCCGGCGTCGATAGGTGACGGAACGGAGATTAACATCGATGCCGGCGAAGGAGAGGACGAGGAGTGCTGGGGGCCCCTGTGTCAACCG 582 MR2286 Reverse 186843 186978 136 116.5 UACAUCGAGCCGGCGUCGAUAG UUAACAUCGAUGCCGGCGAAGG
543 CGGCGCGGCGGCGGAGGGGCCGACAGACCGAGCAGGAGCAGGCCGCGGCGAGCAGGGGATGGCGCGTCGGCAGGTCGGCAAGGTGCGGAGGCTGTTGCCGCTGCTCACCGTCGTCGGGATGCTGCTGCTCGAGCCCGAAAAGTCCTCGCGAGCCGGTGCGCTG 307 MR2296 Reverse 187518 187680 163 129.6 CGAGCAGGAGCAGGCCGCGGCG UGCGGAGGCUGUUGCCGCUGCU
544 GGTCTTGAACCACGTCGGGGACGGCGGCGAGGAGGTCGGCGACGCCGTCGGTGAACCCTCCGGTGAGCTCGCCGGGGAGTCCGCGGGCGAAGCGACCGCCGGCGAAGCCCCCGCGGACTTGGCGAAAAAGACC 263 MR2300 Reverse 187754 187886 133 132.9 CCUCCGGUGAGCUCGCCGGGGA GGGAGUCCGCGGGCGAAGCGAC
545 GCGAGGAGACGGCGGTGGAGATCGACAGCATCGACGACTGGTCCTCGGTCTTCCAGCCGTGCAGTCCGTCGTACGCCGAACGCGACCAGGACTCTCGCGAGCTGCTGATCGACCTGCCCCCGCCGCCCGT 118 MR2304 Reverse 188086 188215 130 144.8 AGCAUCGACGACUGGUCCUCGG AGGACUCUCGCGAGCUGCUGAU
546 CGGTACGGCGCGAATCGGACGCCAAGTACCGTTTCCCGGGGCGAAACGACGAGATCTACGTGAACTGGGAGCCGCTTAACTGCGGCTACTACTCGCCGTCGACGCGCTCCGCGGACTCGCGGTTCTCGTCGTGGGCTGTATCG 564 MR2332 Reverse 190579 190721 143 117.2 ACCGUUUCCCGGGGCGAAACGA UACUACUCGCCGUCGACGCGCU
547 ATGGCTGGGCGCCGTGCAGTGCGCCGTGCAGACGGCCGTCCAGGTGGCGGTGCAAGTAAGTGCCCATCAT 513 MR2339 Reverse 191155 191224 70 119.2 CGUGCAGACGGCCGUCCAGGUG UGGCGGUGCAAGUAAGUGCCCA
548 GGAGAAAGGGGCGGGTGTGAAATGACGTGGGCGCTTGACGTTGGAAAGCATAAATGCCAGCGCGTCGAGCGCCCCGGTCGCATTCGACGTCTCT 252 MR2346 Reverse 191700 191787 88 133.4 CGUGGGCGCUUGACGUUGGAAA AGCGCGUCGAGCGCCCCGGUCG
549 TCTCGATCCAGGCCCTCATGTCGTGCGTGTGTTTATTGGCGGGGCGTCTGCGGGACGCGGGTCAGGCCGGGTTTTGTAGCGCGAGACCGCGTCAGGAAGCGGCGGACGGGACGACATGGTGGTTTCTAGGGGGAG 138 MR2386 Reverse 195226 195359 134 142.0 GAUCCAGGCCCUCAUGUCGUGC GGUUUUGUAGCGCGAGACCGCG
550 CTGTGGAGCTCCGACCTCTGTTGCGCTCCGCCGAGAGGACTGGGCGTGGACGGAGATAGGGAGTGAGCTTTATAG 302 MR2387 Reverse 195477 195551 75 129.8 CGCCGAGAGGACUGGGCGUGGA ACUGGGCGUGGACGGAGAUAGG
551 TGCAGCAACGCGACCAGCTGGCGGGCCGGCTGCGCAACCTGGAGCTGTAGCGTCGGTTAACCGCTGCTGGTACTGCCACTGGCACCGTGCTTCTGCA 272 MR2390 Reverse 195743 195839 97 132.1 CUGGCGGGCCGGCUGCGCAACC GGUUAACCGCUGCUGGUACUGC
552 TCCGCTTCAACGTATTCCGTCTGCGTACCCCGCTGTTGGCGAGCAGGTCGGGCGTCGGGGAGGTCATGCTGTGGGTCGGCTTTCTCCCCCGGGAGCTGGGCGGGTTGCTGTGGCCGCTGCGGGACGAGAGACACGAGCCTGAGGAGGCGGA 474 MR2400 Reverse 196685 196835 151 121.1 UUGGCGAGCAGGUCGGGCGUCG UUUCUCCCCCGGGAGCUGGGCG
553 GAGAAAGTCCGCTTCAACGTATTCCGTCTGCGTACCCCGCTGTTGGCGAGCAGGTCGGGCGTCGGGGAGGTCATGCTGTGGGTCGGCTTTCTC 94 MR2401 Reverse 196750 196842 93 148.3 UAUUCCGUCUGCGUACCCCGCU UCGGGCGUCGGGGAGGUCAUGC
554 GCGGTGCCGTTGCTGGAGGTGGACGTGCAGAGACGCTGGGTCAAACCGTCTTCAGCGTCTCCGGCGACGTCGATGACTGCTACGGTCCCGT 58 MR2404 Reverse 196995 197085 91 155.4 GUGGACGUGCAGAGACGCUGGG CUUCAGCGUCUCCGGCGACGUC
555 CGGGCAGCGGGGAAGGGCGAGTAGCAGCGCCAGCTCCCGAGCTCAGGAGCTCGCCGCCGCTCTCGTCCGCCGACTCCTCG 493 MR2418 Reverse 197734 197813 80 120.0 AAGGGCGAGUAGCAGCGCCAGC AGCUCGCCGCCGCUCUCGUCCG
556 GGTCGGGAAACGATATACAGCGGGAGAAACCAATGGCCCGGCGTCCACCGGAGCTAGCGGGGATGTTGTGGTGGTGGTGGGCGTTGACAGCGTTCTTCCCGACT 586 MR2422 Reverse 197896 197999 104 116.4 AAUGGCCCGGCGUCCACCGGAG GGGAUGUUGUGGUGGUGGUGGG
557 GTGCACGCGCGTCACCCCTGAAAACCGCGTGTTCTCTCGGCCCTCGCGGAGCACGTAGTTTTCAGAGGCAAACGGCGAGAAGCGC 213 MR2447 Reverse 200877 200961 85 135.6 UCACCCCUGAAAACCGCGUGUU CGGAGCACGUAGUUUUCAGAGG
558 GGGGCGCCGGGCGGTCCTCCGCCGATGGCGCCTGCTTGGCCTCCGGCGTGGGGCTTGCACGTGGTGGGGTTGTGCACGTTGGGGTGGGCGTGCGGTCGTCCC 95 MR2449 Reverse 201138 201239 102 148.2 UGGCGCCUGCUUGGCCUCCGGC GGUGGGGUUGUGCACGUUGGGG
559 TGCGCCAGCAGGAACCGCTCCGGGCTGTTCCAGAAGTTGAGGCTCGGCGGGGCGCCGGGCGGTCCTCCGCCGATGGCGCCTGCTTGGCCTCCGGCGTGGGGCTTGCACGTGGTGGGGTTGTGCA 47 MR2450 Reverse 201164 201287 124 158.5 UGAGGCUCGGCGGGGCGCCGGG AUGGCGCCUGCUUGGCCUCCGG
560 ATGGTGGCCACCAGCACGATCCAGGGGTCGCGCGGCGAGAGCTGGCGCAGGTCGGTGGCCCCGACGCCGGCCATCTGGCTGCGCGGCGTGATGCGCGCGTAGAAGCCGTACGGCCGGCCCAGCGGGAGCAGACCGCCGGCCTCTCGTTGCGCCCACTTGCGCATGGCTCGGCTGGTGGTGTTAGCCAT 576 MR2454 Reverse 201361 201548 188 116.6 ACGCCGGCCAUCUGGCUGCGCG AGACCGCCGGCCUCUCGUUGCG
561 GTCCGGGCGTCTGCAGCGGGATGCCCGTGTGCTGCCACCGGCGGCGCAGCTCGCGGCCCAGTTCGTTCACGTCGTCGCTCTTGGTCAGCGTCCGCAGCAGCGCGGGCTCGGGGACAGCGGTGGCCCGCGGCGCGTTCAGCCCCAGCCGGTTGGACCGATACAGCCGCGCCACGTCGCCGGCGCCGTAGCGGAACCATTCGTCGGCGTCGCGGGCGGCTAGGGTCAGCGTGTTGCGCTGCAGGTCGTAGATGAACACCCGAAAGTTGACGCCCAGGGC 257 MR2459 Reverse 201652 201928 277 133.0 CGGCGCAGCUCGCGGCCCAGUU UUGGACCGAUACAGCCGCGCCA
562 GGGCCGCTCCCAGTGCTCGCGGTCGAGGTCGGGCAGGAGGCGCAGGGCGGCCTCGGCGGGCGGGGCGGAGACGCGGCCC 422 MR2472 Reverse 202785 202863 79 123.2 CAGUGCUCGCGGUCGAGGUCGG AGGGCGGCCUCGGCGGGCGGGG
563 AGCGTGATTCGTCGAGATCCATCCAGGCCAGCTCATCGTGAACGGTACTTTGCGGACACCAGCTCTCGTCGTCCGTCCGGAGGGCGTTACACAGGCTGGCCTGCGGACTGAGCGGTTCGGTT 249 MR2477 Reverse 203157 203278 122 133.5 UCGAGAUCCAUCCAGGCCAGCU CGUUACACAGGCUGGCCUGCGG
564 GGCGGTGAACATCTGGTGGTGGCATTCTGCCGGCACGACGGGCATGGGACGATCGATCTCGGCTCCGGCTCGCAGAGTGCCTTTGGCCAGGCGGCGCTGCT 128 MR2480 Reverse 203312 203412 101 143.9 CAUGGGACGAUCGAUCUCGGCU CGGCUCCGGCUCGCAGAGUGCC
565 CGGCGGAATCTCCTCGTAGATGTGCTCTTCATCGTCGTCCTCGGGTTCGGATCCGCACAGTGGGATTACCTGGTGGCCTCCGGCGGTGAACATCTGGTGGTGGCATTCTGCCG 248 MR2481 Reverse 203381 203493 113 133.5 CAUCGUCGUCCUCGGGUUCGGA CCUGGUGGCCUCCGGCGGUGAA
566 GCGAACTGGCCTGGCGGCGGGTGGCCGACGACTCGCACGACTTGTGGTGCGCCTGCATGGACTGGAAGGCGCACGTAGAGTACGTGGGGGTCTCGGCCGAGCTGAGGCCGGGCTCCGGCGC 1 MR2494 Reverse 204345 204465 121 194.1 CCUGGCGGCGGGUGGCCGACGA AAGGCGCACGUAGAGUACGUGG
567 TAGTGTGGTTGACCTGCGTGCCCGAGATCCGGGTGGACTACACCTCCAATGCCTACATGTGGAACATGCAGTACGGGATGGTCCACCGGTCTTACCGGCACGTGGCTTTGGCCGTCCTG 148 MR2499 Reverse 204982 205100 119 141.4 CGAGAUCCGGGUGGACUACACC CAGUACGGGAUGGUCCACCGGU
568 CCGTCGGTTGGTACTTCCAGCGGGCCATGCGGGACGATAACTGGGGTCTGTTCATGAGAACCGTGTGCGTCTACGTCCTGTCCATGTTCATGCTGGCCTACCTGACCGTGG 322 MR2510 Reverse 205892 206002 111 129.0 UACUUCCAGCGGGCCAUGCGGG GUCUACGUCCUGUCCAUGUUCA
569 GCCGCCCGCACGTATCGCGACGGGGAGGTGTACGGGGCTGTTGTATCGTCACTATCGCGACATAACATCCCCCTGCACGTCCATGTCGCGACACGTCCACCCGACCGTGGGTCGC 75 MR2520 Reverse 206823 206937 115 151.7 AGGUGUACGGGGCUGUUGUAUC AUAACAUCCCCCUGCACGUCCA
570 ACGCGCCCCCCGAAGACCTGCTATCCCTGTTTCATCGGCGGCAAACCTGCGTGCCGAAGAAGAGGATCGGAGTCTCGGAGTGCCGT 491 MR2528 Reverse 207472 207557 86 120.1 UCGGCGGCAAACCUGCGUGCCG UGCCGAAGAAGAGGAUCGGAGU
571 GGAGAGGCGGAGACATCGTCACGCCTATCATAAAGAATGACACGCTTTCAAGATAGGAGTGGCGAAAGCCTTCGCCTTTCC 482 MR2532 Reverse 207914 207994 81 120.6 CGGAGACAUCGUCACGCCUAUC AGUGGCGAAAGCCUUCGCCUUU
572 TCTTCGACTATCTGTCGGGCGACGGCTTCGACCGCGAGCTGTAGCCGTCGTCCGGGGGAGAGGCGGAGA 387 MR2533 Reverse 207982 208050 69 124.8 UAUCUGUCGGGCGACGGCUUCG AGCCGUCGUCCGGGGGAGAGGC
573 CGGTGGGGTCATCTGGAGGCTCCCCGGCGCGAGGTGAGCCGCGATTCGGCTACCTTTCGTCTGACCCAACGGGTGCCTCCCG 485 MR2549 Reverse 209334 209415 82 120.5 UGAGCCGCGAUUCGGCUACCUU UACCUUUCGUCUGACCCAACGG
574 GGCGACTGGAGGATGATCCGCTGCGTCCTCGGCGCCTGGCTGCTGAGCCTCGGCGCGACGGACAGGCAGGAAGGATCGTCGTCGCC 214 MR2576 Reverse 211290 211375 86 135.6 UGAUCCGCUGCGUCCUCGGCGC CGGCGCGACGGACAGGCAGGAA
575 CGACGGCGGTGTCAGCGAAGACATCCCGCTGCAGGACGTCTCCGGGGACACCGCCGCG 184 MR2580 Reverse 211797 211854 58 137.9 AAGACAUCCCGCUGCAGGACGU ACGUCUCCGGGGACACCGCCGC
576 GGCCCGTCGCTGGGAGACCATCTGCTCGCGGGTGCTGACCAGCGTCTTCTTCATCACGCTCTGGGTCATCGGCGACCAGACGGTCTTTCGACACCAGCGCGTTATCCTCTACGGCT 585 MR2597 Reverse 213555 213670 116 116.5 CUCGCGGGUGCUGACCAGCGUC UGGGUCAUCGGCGACCAGACGG
577 GCCTGCTCCTCGTCCGTCATGGTGGTGGGCGCGGGGGTGCTGGCCTGCATCCTCTTCGCGATCTGCACCGCCGTGGCCTGCCTGGGCGGC 137 MR2646 Reverse 217415 217504 90 142.0 GUCAUGGUGGUGGGCGCGGGGG UCUUCGCGAUCUGCACCGCCGU
578 CCGCCGTCCGCCACCGTGCTGACGATCTACAGCGTGGTCACCACCCTGTCGGTGGTGGTGGCCAGCGCCTGCTCCTCGTCCGTCATGGTGGTGGGCGCGG 38 MR2649 Reverse 217471 217570 100 160.0 UCACCACCCUGUCGGUGGUGGU UGGUGGCCAGCGCCUGCUCCUC
579 TCAGCCTGGCGGTGCCCACGGTGTGCCTGGCCGTGTTACACAGCAAGTACGAGGACCGGCCGCCGTCCGCCACCGTGCTGA 614 MR2650 Reverse 217549 217629 81 115.2 CCACGGUGUGCCUGGCCGUGUU ACGAGGACCGGCCGCCGUCCGC
580 ACGGCGAGCGACGTGCACCGCTTCCTGGTCTGCACGCGGGTCTACAGCACCGTGGCCATGCAGGCCACCTGCACGTTCCTGCTGT 437 MR2653 Reverse 217705 217789 85 122.6 UGCACGCGGGUCUACAGCACCG AUGCAGGCCACCUGCACGUUCC
581 TGTGTTGTGGACCCGCTCTCCACCCGCGTCTGTGGTGTCTGCGTCCGTGGCCGGGCGGGGGGCCGGGACGGCACA 449 MR2656 Reverse 217939 218013 75 122.0 UGGACCCGCUCUCCACCCGCGU UGGCCGGGCGGGGGGCCGGGAC
582 CGCTTCACGCGGCACGCCTGGCTCACGGTGGCCTGCCTGGTGATGAACACCGGCACCACCGTGGCCACGGGTTTCTGCGGTGAGAGGAGCG 97 MR2663 Reverse 218526 218616 91 147.6 CGCCUGGCUCACGGUGGCCUGC CCGGCACCACCGUGGCCACGGG
583 GCCGCTGTCGCTGGCCATGCTGCGCGGCGTGGCCGAGTACCGCCCGCGCTTCACGCGGCACGCCTGGCTCACGGTGGC 433 MR2665 Reverse 218585 218662 78 122.7 UCGCUGGCCAUGCUGCGCGGCG CCCGCGCUUCACGCGGCACGCC
584 GCGCCCACGGCGTGGTGCCGGCCATGTCCTCCGTGGTGCCGCCGCTGTCGCTGGCCATGCTGCGCGGCGTGGCCGAGTACCGCCCGCGC 261 MR2666 Reverse 218614 218702 89 133.0 GCCGCCGCUGUCGCUGGCCAUG CGGCGUGGCCGAGUACCGCCCG
585 GCTTCAGGATGCTGGTCGGGGTCTACCACGGCCTCGCCTGGCAGCTCTCCTGCACCTTCACGGTCTGCCTGCTGGCCTGGTTCGCCTTTCCCGACGTCCGGGGC 525 MR2667 Reverse 218707 218810 104 118.8 CAGGAUGCUGGUCGGGGUCUAC UCUGCCUGCUGGCCUGGUUCGC
586 CGGTGGAGAGGGACGAGGCGCCGCCGGCCGTGGCCGCTTACCGCCGCGCGCTGGCGGCCGAACCGTACCTCTTTCACTG 149 MR2668 Reverse 218819 218897 79 141.3 AGAGGGACGAGGCGCCGCCGGC CGCGCUGGCGGCCGAACCGUAC
587 CGCCCGCCGCCGCCGCCGTCTCCTCCGCCTTCGCCGCCGCCCTCTTACCGGGAGACGGTGGAGAGGGACGAGGCGCCGCCGGCCGTGGCCG 86 MR2670 Reverse 218862 218952 91 149.5 CGUCUCCUCCGCCUUCGCCGCC ACGGUGGAGAGGGACGAGGCGC
588 GAGCGCTTCGCGGTCTGGCTGCGCGTGGCGGTCATCGTCAACTTCCAGCTGACCGTCACCGTGCTGCTCAGCGCGCTGCTATGGTCGCTC 368 MR2683 Reverse 219693 219782 90 125.7 UGGCUGCGCGUGGCGGUCAUCG ACCGUCACCGUGCUGCUCAGCG
589 TCCTGGCGTTGGCGCTGTCGGGCCACGAGAACTGGATGCAGAAGCTGATCATGACGCTGAGCGCCTTCTCCATCAGCTTTTTCCTGGGCATCCTGGCCTACGACACGTTATCGGTGA 341 MR2687 Reverse 220173 220289 117 127.9 AGAAGCUGAUCAUGACGCUGAG UUCUCCAUCAGCUUUUUCCUGG
590 CGTGCTGTACTTCATGCCCGTAAACCGACCGACGACGGGCGCGACGCAGAATTTCGTGTCGTAGTAACGTGCCGAGACGACGGCGACGACGGTCCGCGTCGCGACGTCATCGTCGGGAACTCGCGCGCTTGTGTATAAGAGTTAGCGCG 76 MR2697 Reverse 220827 220975 149 151.6 CGACGCAGAAUUUCGUGUCGUA GACGGCGACGACGGUCCGCGUC
591 GGCCGCGTCGGCGCTGATCCTGCTGCTGTTCCTGGTGTTCTCCCTGTTTCCCGAGGAGGTGGGCGAGATCGTGGTGATGGTGGCCGGGCTGGCGGTGATCGTGACC 151 MR2699 Reverse 221080 221185 106 141.1 UGCUGUUCCUGGUGUUCUCCCU UGGGCGAGAUCGUGGUGAUGGU
592 GGTGACGGCGTCGGGCTTCCACTTCAGCCACCGCTCGGTCATCTACGCCATGATCGCCACGGTGGTGCTGTTCTGCTTCCTGACGCTGGCCACC 489 MR2702 Reverse 221230 221323 94 120.2 CCACUUCAGCCACCGCUCGGUC CAUGAUCGCCACGGUGGUGCUG
593 GGTCTGTGTGTCGCGTGTCTCATTCGTCGTCAATGTATTTAGACGGGACGTGGGTACGGAGGGTGAGAAAGGGGGGAGGCGCGGCGGGACC 120 MR2707 Reverse 221599 221689 91 144.4 UUUAGACGGGACGUGGGUACGG AAAGGGGGGAGGCGCGGCGGGA
594 CACATGTTTCTCAAGTGCGGCCTGCTCAAGACGCGCGGCCTGTGCCGCTTCGACCGCGGGCTGCGCGGCGAGTGTCGCCTGGAGGAGCTGCCCGTGTG 52 MR2724 Reverse 222559 222656 98 157.0 CCUGUGCCGCUUCGACCGCGGG GGGCUGCGCGGCGAGUGUCGCC
595 CGGCCGCCATCCCGCAGATCTACGCACGTTCGCTGGCCTCCGAGTATCTGTGCTGTGACGATGACCTGGAGGCCGTCGGCGTGCTGGCCGTGCGACCGGCGGACG 44 MR2734 Reverse 223244 223348 105 159.1 GCACGUUCGCUGGCCUCCGAGU UGACCUGGAGGCCGUCGGCGUG
596 CGCCCCACCTCCCGGGCCGTGACGCCGGCGCGGCGGCCCAGACTCGAGAGGGACCGCTCCCTATATTAAGCTTTGACGCCGCGCCGGGGCGCCACACGGCCCGCGTCGGGGCG 193 MR2738 Reverse 223616 223728 113 136.9 CGUGACGCCGGCGCGGCGGCCC UAUUAAGCUUUGACGCCGCGCC
597 GCATTTCACCATGTTCGACAGCGGTGTGGACCGCGACTACGGGCGTCAGTACCGCTGGCTCTGTCGCGGCGACCGCTTTCGGGCCGAGATGC 255 MR2746 Reverse 224401 224492 92 133.1 UCAGUACCGCUGGCUCUGUCGC CUCUGUCGCGGCGACCGCUUUC
598 CGCGTCCCGCACGACGTGGTGCGGGCGCTGCTGCACAACTGCCGGAGCCCCGACGCGCTGGCCGCCTGCGTCGGCGAGCACCACGGGCGGGACGTG 477 MR2752 Reverse 224942 225037 96 121.0 UGCGGGCGCUGCUGCACAACUG CGGCGAGCACCACGGGCGGGAC
599 TCGAGCGGCAGCACAGCGCCGAGGTGGTGCGCGACTGGGTCCGCAACCACGTCGACCAGGTGCTGTCGCTCGG 391 MR2760 Reverse 225348 225420 73 124.6 UGCGCGACUGGGUCCGCAACCA AACCACGUCGACCAGGUGCUGU
600 GAGCCGGGTGCGAGGGACGCGGAATAAAGAGTCGCTGGGTTCTGAGCCGTGTCTCGAGTGATTCTTCTTGTTTCTCCTCCTTCTCCGGCGCTCGGGTT 65 MR2765 Reverse 225548 225645 98 153.7 CGCGGAAUAAAGAGUCGCUGGG GAGUGAUUCUUCUUGUUUCUCC
601 TCTGTTGGGCGTGACGGGCCGGCCGCGGCCGGGGCGCGCCTTCGTGGCCGAGGTGCTGGTGCTGCTGGACTGGTTCGGCGCCGTGTACGCCATCCAGA 145 MR2771 Reverse 226240 226337 98 141.6 CGCGGCCGGGGCGCGCCUUCGU UGCUGGUGCUGCUGGACUGGUU
602 GCGCTGTACCGTCAGGTCCTACGGGACTTCAAGGACCTGTTCATGTGCCTGGATCCCCTGGAGATCACCCGTTTCGTGCAGCGC 466 MR2776 Reverse 226973 227056 84 121.4 UCAGGUCCUACGGGACUUCAAG GCCUGGAUCCCCUGGAGAUCAC
603 GGGGGCCCGGCGCGGAGGGGGCCGCGGAGGCCGCGCTGGCCGCCGTGGTGCCCCCGCAGCTGCCCTC 562 MR2781 Reverse 227109 227175 67 117.2 CCGGCGCGGAGGGGGCCGCGGA CGUGGUGCCCCCGCAGCUGCCC
604 GCGCCAGGGCTGGGAACCGCTCAGTGGCTCGGACCGTCATCTGTCTCGACTGCGGTCCGAACGCTAGGCCGGTTCTCAGACCGAGGCGC 2 MR2784 Reverse 227268 227356 89 192.9 CCGCUCAGUGGCUCGGACCGUC UGCGGUCCGAACGCUAGGCCGG
605 CGTGGGGTCTTTCGGGTAGCGGTGTTTCTCAGAGGATGACCGACGTGACCTGGGAGGTCGTCATCCACTTGGGAATCTCCGACGGTCCGATTGGCCCCCCTGGCG 601 MR2790 Reverse 227469 227573 105 115.7 UGUUUCUCAGAGGAUGACCGAC CGUCAUCCACUUGGGAAUCUCC
606 CGCGCCCAACGGTTGGCGGTTGGATTTCGTGGAGTTTCAAGACATTTTCGGCGAGTCGGCCGTCATCGACGGGCCCG 593 MR2813 Reverse 229315 229391 77 116.1 UGGCGGUUGGAUUUCGUGGAGU GGCGAGUCGGCCGUCAUCGACG
607 GTGTCTTCCACCGGGACCTTATCGTTCTTACCGTGATAGGAGGCCTTTTTGCTATCTTTGAGCCGTCTCTGAAAGTCTTTTTTCACCTCGAGGTCGATGTCCTGGTAGGGCAC 537 MR2832 Reverse 230893 231005 113 118.2 UCUUACCGUGAUAGGAGGCCUU UCUCUGAAAGUCUUUUUUCACC
608 GGCACCTAAGATGATCTCGGTCTTAAGGATGATGGGGTAGCTGCGCTCCAGCTGCTCGTAGTCGTTCATACACTGGTTTTGTTTCTTGGTGACC 129 MR2838 Reverse 231707 231800 94 143.7 CUCGGUCUUAAGGAUGAUGGGG CUGCUCGUAGUCGUUCAUACAC
609 CACGGTTGATTGTGCCCGGACCGTGGGCGCGACGACATCCACCGTCACGGTCCGAGCACATCCAAACGTG 90 MR2846 Reverse 232489 232558 70 149.1 GAUUGUGCCCGGACCGUGGGCG GUCACGGUCCGAGCACAUCCAA
610 TCCGCTACGGCGCCGGCGACGTGGCGCGGCTGTATCGGTCCAACCGGCTGGGGCTGAACGCGCCGCGGGCCACCGCTGTCCCCGAGCCCGCGCTGCTGCGGA 284 MR2929 Reverse 239678 239779 102 131.3 GGCGACGUGGCGCGGCUGUAUC UGAACGCGCCGCGGGCCACCGC
611 TGCGCAAGTGGGCGCAACGAGAGGCCGGCGGTCTGCTCCCGCTGGGCCGGCCGTACGGCTTCTACGCGCGCATCACGCCGCGCA 215 MR2939 Reverse 240047 240130 84 135.4 CAACGAGAGGCCGGCGGUCUGC GCCGUACGGCUUCUACGCGCGC
612 GCTTCTCGCCGTTTGCCTCTGAAAACTACGTGCTCCGCGAGGGCCGAGAGAACACGCGGTTTTCAGGGGTGACGCGCGTGC 374 MR2944 Reverse 240557 240637 81 125.4 UUUGCCUCUGAAAACUACGUGC GAGAACACGCGGUUUUCAGGGG
613 GTCTATCCGCGCAGCGAGTGTGGCGCGTGTTTGCCGTGGCCGGGATCGGTGAGTCACGGAACCGGTTTCCGCGGCGGCGTGCGGCGGGCCGGCCGGTCGGAC 26 MR2947 Reverse 240985 241086 102 167.7 CGCGUGUUUGCCGUGGCCGGGA AACCGGUUUCCGCGGCGGCGUG
614 CGCGTGTTTGCCGTGGCCGGGATCGGTGAGTCACGGAACCGGTTTCCGCGGCGGCGTGCGGCG 304 MR2948 Reverse 241001 241063 63 129.6 UUUGCCGUGGCCGGGAUCGGUG CGGUUUCCGCGGCGGCGUGCGG