Chershoee
S.No. Sequence Rank Name Orientation Start end size Score 5`Stem 3`Stem
1 GCCGCTTTCGGGCCCGGGGGTGTCGGCGCGAGGCGGCGCCGGCGGCGCTGGCGGCGCTGACGCCCCCGAGGCCCCTGAGGCCGGC 78 MD9 Direct 656 740 85 145.4 CUUUCGGGCCCGGGGGUGUCGG UGGCGGCGCUGACGCCCCCGAG
2 GACGCCCCCGAGGCCCCTGAGGCCGGCGAGCCGGGGGCCGCGTCGCCCATGCTCCCCGGGCGGCTGTCCGGGCGGCTGTCCGGGCGGCTGTCGACGGCGCCTCGGGCTCGCCTCGGCCTCCGGCGGCGTCTCGCGGCCGTC 5 MD10 Direct 714 854 141 183.6 CCCGAGGCCCCUGAGGCCGGCG UGUCCGGGCGGCUGUCGACGGC
3 GCTGTCCGGGCGGCTGTCGACGGCGCCTCGGGCTCGCCTCGGCCTCCGGCGGCGTCTCGCGGCCGTCTCGAGAGC 23 MD11 Direct 788 862 75 164.9 UCGGGCUCGCCUCGGCCUCCGG CGGCGGCGUCUCGCGGCCGUCU
4 GGAGTGCTGTTTGGAGAGCGGAGGGGAGGGGAGCGCGGAGGAGAGGGCATGGCCACGTGGGGGGGGGGCGATGGCACCTACTGCCTGCTCCCGGGGCTCCTGCTGCTCTTCCGCGTGGGCCCAGGCGGTCCCGTCTCCCAAACCAGCTCC 126 MD25 Direct 1746 1895 150 138.2 AGGGGAGCGCGGAGGAGAGGGC GCGGUCCCGUCUCCCAAACCAG
5 TCGAGCTAAAACTATCTACATGTGCACACTGTGACGTTATTAAGCATACCTGTCGACTACCGCCCACAGACGTATCTCTGTCACGTTACACTCTGCTAACAATCGTAGATGTAGCCAGA 180 MD51 Direct 6062 6180 119 130.5 UGACGUUAUUAAGCAUACCUGU GACGUAUCUCUGUCACGUUACA
6 GGCATGGGACCGCCACTGCTTCGCGACCAGCTGCCGCCACCCACACGGCAGCCGGACCCGCAGCAGTCGCGGTCTCCAAAGTGCC 156 MD77 Direct 9096 9180 85 133.8 CCACUGCUUCGCGACCAGCUGC AGCCGGACCCGCAGCAGUCGCG
7 TGCTATGGAACCGACCTGCACACTACTGTACTTTAGTGTTCAGTTACCACAGCCTAAACACTAGCGTGCAGTTGTGTACAGACGACTTCCAAGAACGGCA 17 MD81 Direct 9562 9661 100 169.1 CACACUACUGUACUUUAGUGUU AAACACUAGCGUGCAGUUGUGU
8 CGGAGCTCGATCCGACGGAAAGCCAGCTTGTCTATCGGCAGATGTTTATGTTTGACCACCGTATAGACATTTGCCAATAGCATGCTCGCCAATCCGTACTATCATCGGTCTTCG 30 MD83 Direct 9664 9777 114 158.9 CUUGUCUAUCGGCAGAUGUUUA AGACAUUUGCCAAUAGCAUGCU
9 AGTGACCTTCCGCTACATTATATACATATATATTTGTATATATATACATATATACAAATATATATGTATATATGTATAGCCCCACATCACT 102 MD109 Direct 13143 13233 91 141.5 CAUUAUAUACAUAUAUAUUUGU UACAAAUAUAUAUGUAUAUAUG
10 GTCTCGTCTTCCGATTCTTCGTTTTCCATCTTGGTGCACAAGAGTTCAAACGAAGGATCGGTGAGAGAC 271 MD284 Direct 38465 38533 69 120.1 UUCCGAUUCUUCGUUUUCCAUC UUCAAACGAAGGAUCGGUGAGA
11 GGTAGCTTTCATCAACCAGAGCTCTAATGTTATGAAGAACCGCCACTTTTATTACGGGTTTTGTAAAGATGCCGAGTTACT 322 MD478 Direct 64352 64432 81 116.8 AACCAGAGCUCUAAUGUUAUGA ACUUUUAUUACGGGUUUUGUAA
12 CGTGTCGGGGTTTGCATACAAGAATTACGGAATGCTCGATATCTGTCACCATTCCGCAGTTCTTATATACGTTCCCCGTAACGC 166 MD585 Direct 76826 76908 83 132.4 UACAAGAAUUACGGAAUGCUCG CAUUCCGCAGUUCUUAUAUACG
13 CTCGGGGCTCGGGGCTCCAGGCCTGCCCGGGGAAGCTCTTCTGGGCTTCGGTTAGCGGCCATCTTGGTGCCCAGCAGCGGCTCCAGGAGCGGACGCAACGTTGCTTCAGGAGGTTTCTTCCGGGTAGGCATGCCCTGGTTCCCGGG 41 MD593 Direct 77900 78045 146 153.3 GCCCGGGGAAGCUCUUCUGGGC UUGCUUCAGGAGGUUUCUUCCG
14 CCGGGTAGGCATGCCCTGGTTCCCGGGGTACCGTGGGTTCCCTGCGCTTTGGGCACCCGGGGTACTGCGGGTTCCGGGCCTGAATCTCGG 242 MD594 Direct 78019 78108 90 122.0 UGGUUCCCGGGGUACCGUGGGU CACCCGGGGUACUGCGGGUUCC
15 CGGGTTCCGGGCCTGAATCTCGGGCACAACCACGTGCCCGCGTGGTTGTGGGCTCGATTCGGGTTTCGGACCTG 107 MD595 Direct 78086 78159 74 140.2 CAACCACGUGCCCGCGUGGUUG UUGUGGGCUCGAUUCGGGUUUC
16 CCTGAATCTCGGGCACAACCACGTGCCCGCGTGGTTGTGGGCTCGATTCGGGTTTCGGACCTGAGTCGCGGGCACAACCACGTGCTCGCGTGGTTGTGGGCTCGATTCAGG 9 MD596 Direct 78097 78207 111 179.8 UCUCGGGCACAACCACGUGCCC AGUCGCGGGCACAACCACGUGC
17 TTCTGAAAGCGCCGATGGTCAGGTCGGCGATCATGCCGCATCGATACGCTTCGATAGCGTGGTTGTCATCGAATCTGGACAAAAACATCGGGGTGTTCGAA 150 MD614 Direct 79153 79253 101 134.4 GUCAGGUCGGCGAUCAUGCCGC AUAGCGUGGUUGUCAUCGAAUC
18 GGCTTTCTGACATCGTCCCGGTACGGAATCAGACCGAGTGACTCTGCGGTGTATCTCTGGAGGTCGTACGGGGGCGATGTTGAGCT 245 MD621 Direct 79788 79873 86 121.7 CGUCCCGGUACGGAAUCAGACC AGGUCGUACGGGGGCGAUGUUG
19 GTAGGTGTCGACGGCGGGTCGGCTGTGACAGGGGCTTCGACGGGACCGGGGTCGACAGCGGTTGTAGATGACATCGGGATCCACGTCGTATCGCCGGGGTGCCGGCTCTCGTCTCGGACGCTTGTTGTCGAGTTCGTAGTCCAAGGCAAACCGTCGGGCTCGGCGCGCTTTGCGCTCAT 11 MD624 Direct 80081 80259 179 173.8 ACGGCGGGUCGGCUGUGACAGG CGUCGGGCUCGGCGCGCUUUGC
20 GTGGTTTCGTCCGTTCCGATGTGGTGGGCGATGACTTCGGAAAGGGCTCGGCGGCGGTATCGAGTCACGTCTAGCGATCGAGTGTCGATGAAATTGC 294 MD636 Direct 80810 80906 97 118.9 UGGUGGGCGAUGACUUCGGAAA UAUCGAGUCACGUCUAGCGAUC
21 TTCTGAAAGGTGTTTTCGGTTTCATTCTGAGTCAAGTAGCGGCATGCTGACCGAGTGGAAGCGCAGATTCTTAAGAG 274 MD647 Direct 81905 81981 77 119.9 UUUCGGUUUCAUUCUGAGUCAA UGACCGAGUGGAAGCGCAGAUU
22 GCAGAAATGGACCAGCTGAGATGCTTTATGTTTCACTAGTAGTGGATAGACGTAGTGGTTGGAAGAAGCTTTCAGTAGGATGTTGGC 349 MD658 Direct 82975 83061 87 115.3 GAUGCUUUAUGUUUCACUAGUA GUGGUUGGAAGAAGCUUUCAGU
23 CGTCGATCCCCAATGGTAGAGTGGTGCTTCGTTCTTCAGCAAGCCAGACGATGTGTTTGTTGAAGAAAGTTAGTCTGTTCTGGCATTGTTTCACG 136 MD680 Direct 84495 84589 95 137.6 AAGCCAGACGAUGUGUUUGUUG UUUGUUGAAGAAAGUUAGUCUG
24 GTGTATATTGGTGGATCCAGAGGTTTGTTTTCTTTTGAGTCGACGGAACAACGACCTTGTTCTATTAAAATCAT 232 MD697 Direct 85487 85560 74 123.4 UUGGUGGAUCCAGAGGUUUGUU CAACGACCUUGUUCUAUUAAAA
25 TTCTAATGAATAAAAGACTTCATTGATGTGGTTATTGTGTCTTTTTATTCAGCAGAG 317 MD708 Direct 86321 86377 57 117.2 AAUAAAAGACUUCAUUGAUGUG UUGUGUCUUUUUAUUCAGCAGA
26 CGTAATTCGTTTTCAAGACTGAAGGAAAATCTGTTTTTTTTAAAAATGGATACG 222 MD729 Direct 87661 87714 54 124.4 CGUUUUCAAGACUGAAGGAAAA UGUUUUUUUUAAAAAUGGAUAC
27 GAAGCTTGATGTAAACGTAATGTTTATTTCACTATGTTGGTCGCTTAGAGTTTGTTCGGCACATGATGTGTGAATTGTGAATATGACATCGTGTTTC 52 MD731 Direct 87875 87971 97 149.5 UUUAUUUCACUAUGUUGGUCGC UGAUGUGUGAAUUGUGAAUAUG
28 GCGTTGTAAAAGTTAAACGTAATCGCGTCGTCTCTGATGGTGCTGGTGTTTCGAAATGTTCCATTAGCACATTGTGTGATGTTAGTTTCTCTCAGGTATCGGATGACCGGATATGGTACGTTGACTATGT 292 MD735 Direct 88248 88377 130 119.0 UAAACGUAAUCGCGUCGUCUCU ACAUUGUGUGAUGUUAGUUUCU
29 TTCGTTCTGCCGGACGTTTCGCGTCACGACATTACGATTTCGTTCGGAGTCTGTAGTGCGTGCTTTGTGTCGTGGGCAAGATGAA 210 MD743 Direct 89073 89157 85 125.6 UACGAUUUCGUUCGGAGUCUGU UGUAGUGCGUGCUUUGUGUCGU
30 CCAGTAGCCGTGCCCGTGTCCGTCGTCGCCGCCTTCGAGCCGCACGTGGACAACGTGCTGTGGGCACCAGAGCGCGTGCTGCGGCGTCTGCGGGACGCCACCGG 252 MD747 Direct 89213 89316 104 121.5 CCGCACGUGGACAACGUGCUGU UGCUGCGGCGUCUGCGGGACGC
31 CTGAAAGAGGAGCTTCGACAATTTCGGGATGCGGTGGCGAATCAGTGTCTCGGTCTCGAGGGTCGTTTATCGG 301 MD750 Direct 89375 89447 73 118.4 AUGCGGUGGCGAAUCAGUGUCU UGUCUCGGUCUCGAGGGUCGUU
32 GCAGATGGAGAGTTTTTCGATTTCTCAAGAGCTTTTAGTTGCGACGGTGGGGGCCCTAGAGAATGTGACTGTTTATCCGGC 270 MD757 Direct 89809 89889 81 120.2 UUCGAUUUCUCAAGAGCUUUUA GGGGGCCCUAGAGAAUGUGACU
33 CCGATATGAGATACTATGTCCCGATGAGTGGGGGGCGACGTTATGCTTCCGGAACTTTTGGTCGACATATTCTGGTGCGG 280 MD762 Direct 90105 90184 80 119.6 UACUAUGUCCCGAUGAGUGGGG GGAACUUUUGGUCGACAUAUUC
34 TTCCGTGGTATCAGTGGGATCCTACCGTGACGGCTTCGCAGTTGTTTCCCGGTGTCGTTTTACTGGCGATTACGGAA 218 MD770 Direct 90573 90649 77 124.8 UGACGGCUUCGCAGUUGUUUCC UCGUUUUACUGGCGAUUACGGA
35 GCCTTTGGGTTACAGCGCCATGACCATGAGTCTACATGTGTGGTTTGCGTTAGCTGCACCGTTGATCGTGGTGGTGTCCTACGTTCTAGGGGC 147 MD781 Direct 91582 91674 93 135.2 CAUGACCAUGAGUCUACAUGUG CUGCACCGUUGAUCGUGGUGGU
36 GGTTGCTCTTGGTAGAGCTGTGTTGTGCCTGTGAAGGTTTTGTAATCATCAATAATAAAGTTGAATATTCCGTATTCGTGCCGTGTTCTTTGGATTTCTAAAGCATTGGGGGTAATTAGCATCTTTCCGGTGGCGATC 184 MD791 Direct 92202 92339 138 130.2 UUGAAUAUUCCGUAUUCGUGCC UUUGGAUUUCUAAAGCAUUGGG
37 CGTGGAGAAAACTGCAGAAAAGTCTGAGGTGGTGGCCTCAGGGCCCCGTGGAGAGCTGACACCTGATCCTGTATTAGAGTTTTTGAGTGGCAGTTATTCTGGCTTGTCACTCTCTAGTCTTCGGTGTTCGGTCAACGCGGCGGAGAGTGTTGGTCCTCTATCGTCGGATGATGGGCGTTATTTTAAACACG 151 MD801 Direct 93191 93381 191 134.3 GCAGUUAUUCUGGCUUGUCACU UGUCACUCUCUAGUCUUCGGUG
38 TAGAGGGGCAGAGTACTTATATCAAAGCCGGTGAACCGACGTCGGTGCCTGCTGTCTGTGATATTAAAGAACAGGATGCTGAGGAGGAAGCGGAGAGTGATCATCCGGCGTCGGTCATGGCACATGCTCTGCCATCTG 318 MD807 Direct 93649 93786 138 117.1 GGUGAACCGACGUCGGUGCCUG AGUGAUCAUCCGGCGUCGGUCA
39 TGAATGCCGGAACGCATGGAGTTTCGGGGGGTGCGGCGTTAGATTCCTCGATTCCGCGTCGGTTGGCGCAGTCGGTTCCCGCGTCGTATCCTCCATCTTTTCCGTATTCA 204 MD809 Direct 93895 94004 110 126.7 CCGCGUCGGUUGGCGCAGUCGG CAGUCGGUUCCCGCGUCGUAUC
40 TTTGGCAGCTGCTCGCAGTGCTATGCAGATGTCGGCGGCACCTATGTCGACATCTTTGTCACCGACATCGTCGGCCACTTCCAGTTGTCAAG 123 MD812 Direct 94379 94470 92 138.7 AGUGCUAUGCAGAUGUCGGCGG UUUGUCACCGACAUCGUCGGCC
41 GCTTGTGGAGGTTCCGGGATGGTGTCACAAGTACCTCGAATGTCAGCCGCCGTTCTTACGTCGCTGTAGTCGGATTTGAGATATGAGGTGGCTTTTATACCTGGGGCAGAGATACTGCAGGT 236 MD816 Direct 94757 94878 122 122.9 AAGUACCUCGAAUGUCAGCCGC CUGUAGUCGGAUUUGAGAUAUG
42 GTGACGGCCATGAACACGTTCCATGAAGGAATTACCACAGTGATGGCTTCGGCGGAAGGTGTCATGGTAGTGC 229 MD819 Direct 94895 94967 73 124.0 CAUGAACACGUUCCAUGAAGGA UUCGGCGGAAGGUGUCAUGGUA
43 CACCTTCCATCGATAGGCCTGCATAATCTTTGGGGAAAAAAACCGCATCGTAACGGTGATTGCTTTCAAATGCATTGTCTATATGGAGGGTG 172 MD826 Direct 95331 95422 92 131.6 AAAAAACCGCAUCGUAACGGUG AAAUGCAUUGUCUAUAUGGAGG
44 GTTTGCGTGTCAGCGAGGGTGACGTTTTGTGGCGAACGCACGATAAAGCCGTTTTCGGGATGTCGACTGAGAAATGGTTCTGGGTTGTGACGAGTGACGACTTCTCCTTGGTGACTGTAAAC 149 MD827 Direct 95426 95547 122 134.4 AACGCACGAUAAAGCCGUUUUC AAUGGUUCUGGGUUGUGACGAG
45 TTGTCTTCGAGTCCATATGATGTCTTTAAGGTTGATTTTAACGTTCCAAAAAAAAGTGGCGCGCTTGATATGGGCTCTGGTCTGGGCTCGGGTGACAG 118 MD833 Direct 95767 95864 98 139.1 UUUAAGGUUGAUUUUAACGUUC GCGCGCUUGAUAUGGGCUCUGG
46 TCTGGTCTGGGCTCGGGTGACAGCGGTGCTTACGTTTTCATCTTGTCTGGTCTTGA 314 MD835 Direct 95842 95897 56 117.6 CAGCGGUGCUUACGUUUUCAUC GUUUUCAUCUUGUCUGGUCUUG
47 GTTCTAAGGAGATCTCGTCAGTGCTGTCTTCTGTGGACGGAGGTTGGCTGATTGTTAGTCCTTTGATATTCAGATCTCGTAATTGGATCGCATCATGTACGGAAGAGATTTCTTGAGC 44 MD839 Direct 96000 96117 118 152.6 UUGUUAGUCCUUUGAUAUUCAG UUCAGAUCUCGUAAUUGGAUCG
48 CGAGTAGCAGATGGCAGAATAATCTGGTGGGCAGTTGGTCTTCTTCTTTGGGACATTCCAGGTAGATGCGAAGTTTCTTTTCAGATGTGAGGGCTTGGACTTTAGTCAAGATGACCGCTTCGTCGGAACAGACGAGATCGGTCACACTGTCAAAGTCTTCGAAAGGAATTCCGTGTGGATCCAAAATAAAGCATGAACTGTGTCTTTGCTCTGTGTCGTCATTCCGGTTGCTTG 171 MD862 Direct 97259 97492 234 131.6 UGGGCAGUUGGUCUUCUUCUUU GAUCCAAAAUAAAGCAUGAACU
49 GTGTCGTCATTCCGGTTGCTTGTCCATATGAGTTGGGTGACTGTCATTCTTACGCTCCAGTGTGAGGCGACACGTTGAACTATGACAT 275 MD866 Direct 97471 97558 88 119.7 CCGGUUGCUUGUCCAUAUGAGU UUACGCUCCAGUGUGAGGCGAC
50 TTCTGTCATAGTTTGGGAGAGGCTCCATTTTTCATTTAAAGTCAGGATATTCTCTGTGGAGTGCATGATGGTGGATAATCGGGAAAGTGGCGGATCCTTCCCAAGTTGTTTCTCGGGA 87 MD889 Direct 99388 99505 118 144.6 AUAUUCUCUGUGGAGUGCAUGA AGUGGCGGAUCCUUCCCAAGUU
51 TCTGTCATAGTTTGGGAGAGGCTCCATTTTTCATTTAAAGTCAGGATATTCTCTGTGGAGTGCATGATGGTGGATAATCGGGAAAGTGGCGGATCCTTCCCAAGTTGTTTCTCGGGATGCGACATGGGAATGATCTGGCTGAACAACTGGGGCCTCAGCCTTTAAATATGCAGG 33 MD890 Direct 99389 99562 174 156.6 CAGGAUAUUCUCUGUGGAGUGC CCAAGUUGUUUCUCGGGAUGCG
52 GGTGAGGATGAGGTGGTGTTTTGCGCGGTGATGTTTCCATTAAATGGAGGTATGCAGCATAGAGTGTCGCCTTTTTCCCA 297 MD902 Direct 100081 100159 79 118.6 AGGAUGAGGUGGUGUUUUGCGC GUAUGCAGCAUAGAGUGUCGCC
53 AGCGGCAAGGGTTTTCGATTAACTCGTCGGTTCCTTCCATGCAAACGTATTGAATATCGGTATCACCGTGGAGACAGTCTTTGGCTCGGACCATGTATTCATCGATGGTCTTGAAGAGTGTCTTATTGGCGTTGATGATGTCTTCGGTGTTAAAAAATTGTGTGCATGGACTGTAGATGCGTGAATTAAAACCTAGTCGTT 72 MD910 Direct 100697 100897 201 146.2 AUGCAAACGUAUUGAAUAUCGG UUGAAGAGUGUCUUAUUGGCGU
54 GGGTGAGCTGCTAAGTCTTCACGTTCTTCTCGTGACGCTGGTGGAAAAAATGCATCGCGGTAAAAGAGATCGACGAGGAGAATCTTGAGGTTCAGACC 310 MD934 Direct 102088 102185 98 117.7 UGGUGGAAAAAAUGCAUCGCGG AUCGCGGUAAAAGAGAUCGACG
55 TTGGTCAGGGCTGGTATTATACAGAAGTAATAAACTTTATGTAACACACAGTCTTCGTCGG 211 MD936 Direct 102205 102265 61 125.4 UACAGAAGUAAUAAACUUUAUG UAUGUAACACACAGUCUUCGUC
56 GCGATTGAGGAAATACACGGCGGTGGGTAGGGTGTTCTGCATGGTGTCGGAGAGCTTCAGTTTGCTCTCCACCGTGGTGTAGCTTCGATCGT 110 MD950 Direct 103275 103366 92 139.6 CGGCGGUGGGUAGGGUGUUCUG UUCAGUUUGCUCUCCACCGUGG
57 GTTTCGAGCGGATCTCGGGTGTCGGTGTTTTTGTAGACGCGGCGGCAATTTTCTAGAGCCACGTTGTGTTCACCGAGCTTAATGACGTCCATTTGGAGC 59 MD953 Direct 103414 103512 99 148.1 CGGUGUUUUUGUAGACGCGGCG ACGUUGUGUUCACCGAGCUUAA
58 GGTTGCATTTTCCACCAGCGTTTGAACTATAAAGTAGGGCGGTGCTTTTCGGAGCAACGTTTGTAGGAAGTTATGAATC 237 MD963 Direct 103974 104052 79 122.8 AAGUAGGGCGGUGCUUUUCGGA ACGUUUGUAGGAAGUUAUGAAU
59 CATCTACCTCGGATGTTTTGTGCTTGTATGACTTTCACGTCTGACCGTTATGTCATGGCGTGTCTTCCGAGTGCTTTGAGTTTACATTTGGATGACTATCCGTATCTGATGGGTGAGATCGGTCATTTTTTAACGATCACTGAGATCGATG 10 MD972 Direct 105084 105234 151 176.6 GUAUGACUUUCACGUCUGACCG UUUGGAUGACUAUCCGUAUCUG
60 TCAGGTGGAGTCCGTCGCGACTGGGAAAGAGGCTGCAGGATCTTCTGCGGCTTCATCGGTACGAGCGGAAACTTCTTCATCGGGA 290 MD981 Direct 105707 105791 85 119.1 CUGCAGGAUCUUCUGCGGCUUC UGCGGCUUCAUCGGUACGAGCG
61 GCATGGAAGGGTGGCTAGATGCTGCGCTCGTGTTACCGAAGTCTGGTCTGGTTCTCGATCATATGTTGGAAAATGAGGGCGTGTCTGATTTCGTGC 86 MD998 Direct 107103 107198 96 144.8 CUGCGCUCGUGUUACCGAAGUC UAUGUUGGAAAAUGAGGGCGUG
62 GCGATGATCAAGTCGTCGGCCTGGCGATTTTTTTTGGCCGAATATGTACTGTTGAGTTCTGTTAAAGTGACACGATGGATGTTTCGAATTTGCTCTAAAAGATATTCGATCGGGTCGTATGATAATTTGATAGTGT 49 MD1013 Direct 108299 108434 136 149.6 UCGUCGGCCUGGCGAUUUUUUU UGACACGAUGGAUGUUUCGAAU
63 TACTGTTGAGTTCTGTTAAAGTGACACGATGGATGTTTCGAATTTGCTCTAAAAGATATTCGATCGGGTCGTATGATAATTTGATAGTG 88 MD1014 Direct 108345 108433 89 144.1 UUAAAGUGACACGAUGGAUGUU AAAGAUAUUCGAUCGGGUCGUA
64 GTTAAAGTGACACGATGGATGTTTCGAATTTGCTCTAAAAGATATTCGATCGGGTCGTATGATAATTTGATAGTGTAGGAGACTAATTCTTGTGAGGCTTTGAC 26 MD1015 Direct 108359 108462 104 163.3 UAUUCGAUCGGGUCGUAUGAUA AUGAUAAUUUGAUAGUGUAGGA
65 GCAGGTGGAGGATGCGGTGTATTTCACATTCAATCGAGTCTTTCGATCGGTTCAGAACGTGCAACGGATCTCTCTACCTGT 77 MD1036 Direct 110189 110269 81 145.6 UUCAAUCGAGUCUUUCGAUCGG GUGCAACGGAUCUCUCUACCUG
66 GTCAGTCGCCGTAAGAGAGAAGATGCGTTATTGAAACAAATGCGTTTCGAGTATGGAAACGCACCTGTTTTCGGATCTTGACTTTCAATACCGTTTTGAT 53 MD1037 Direct 110346 110445 100 149.4 AGUCGCCGUAAGAGAGAAGAUG AACGCACCUGUUUUCGGAUCUU
67 TGTATTTTAAGACGGAGTGGGGTCAAGATTGGCAAAGAGCACTGTTTACTGTGGTGCCGCGAAGATGGTGTCTTCGCCAGTATTTGGATCAACGCGGTCTGAAAAGTCCA 152 MD1040 Direct 110525 110634 110 134.3 AGAUUGGCAAAGAGCACUGUUU AGAUGGUGUCUUCGCCAGUAUU
68 GAAAAGTCCAGATGTCAAGATAGTTTGTCAACATGCAGTTTTTACCACTATTGGCGTCTCTTGTGTTGATCGAGTCATATTAGGAGGTCGATTAGTCTACGTACGTTTTGTCTTGAATCATCGACAGTC 243 MD1041 Direct 110625 110753 129 122.0 AGAUGUCAAGAUAGUUUGUCAA UUAGGAGGUCGAUUAGUCUACG
69 GTCGCCACTTTAGGAGTCAAGAGGAGGCTTCGAGCGACCGCTTGGTCTTGCCGGTGAACGATAGGCCTTTTTTTGAAATTCCTCATGGTGAT 201 MD1045 Direct 110822 110913 92 127.5 UCAAGAGGAGGCUUCGAGCGAC CGGUGAACGAUAGGCCUUUUUU
70 GTTTTGGAACTCTTTGAAGATTGACTATCGAGATGAAGAGGTGGATATTCGACAGTCGTTAGAGACTTATCGTCGTCACTTGGTAGTGGGATCTTCGGTGTTTGAAAAC 8 MD1050 Direct 111192 111300 109 180.1 AGAUUGACUAUCGAGAUGAAGA AGACUUAUCGUCGUCACUUGGU
71 TCTGTATACCACGTGTACGGGGAAAGATTTTTTGCCTTCTTTGGCTAGAATTGTTTCAGCTACCACGTGTTGTGGGGA 191 MD1061 Direct 112351 112428 78 129.2 UUGCCUUCUUUGGCUAGAAUUG AAUUGUUUCAGCUACCACGUGU
72 GATGGAGATACTTACATTTGTGTTGTAGCAGCTGGCGAAAAGAGCCGTGCTCTTGGCTGTCTGATGATCGATGCTGATGACATTATCTTTATT 185 MD1065 Direct 112802 112894 93 130.2 AAAAGAGCCGUGCUCUUGGCUG UUGGCUGUCUGAUGAUCGAUGC
73 GGAACTGCAGCGTCTACAGGTAGATGAGCGTTTGGACTCCTTAACTGAGTTGAAAGACACGGTGGAGGATTCATATTCAGCCCTAGTGGATTCTGTTTCT 192 MD1088 Direct 115060 115159 100 129.2 UUUGGACUCCUUAACUGAGUUG UGGAGGAUUCAUAUUCAGCCCU
74 GCAGTTCGCAACGCTTCTGTGCGGCTGAGATGACGGCGTTAACTAACGTGCTGATGTTCTGTCTTGCCCGGATTTTGGACCGTCGCGGCTTTGAGACTGT 148 MD1102 Direct 116412 116511 100 134.5 UAACUAACGUGCUGAUGUUCUG UGUCUUGCCCGGAUUUUGGACC
75 TTTACTTCGGTGGAAGATCTCGAGTGTGATTGTCGGATCATCTTTCCGGAGTAGA 272 MD1111 Direct 116855 116909 55 120.0 UACUUCGGUGGAAGAUCUCGAG UCGGAUCAUCUUUCCGGAGUAG
76 AAAGAGTCTAGAGGACAAGCCGAGAGTGTGGTGTGGCATGCTATTCGTACGGACACGGTTTCGGCCACACGCTTCTATGAAGCTTTTGTCAATGGAAACGCGTTCATTCCTGTGGAGGCTCGGAAGCCTTGGAGTTCTCCGGCTATGACTTTCGGCTTTCATCATGAGGGTGTGGTCAAGACGCTTATAGAGTTCCACATCATGTGTGGTCGGGAACCGGTACGTGATGGACTGGGCCTGTTGATCGACCCGACTTCGGGCTTGTTTGGGGCTTCTTT 244 MD1121 Direct 117362 117639 278 121.7 CGGUUUCGGCCACACGCUUCUA UGUGUGGUCGGGAACCGGUACG
77 GTTTATGAAATCAAGTGTCGCTATAAATATCTTCGTAAAAAAGAAGATCCTTTCGTGCAGAATGTGTTGAAGCGACATGATCTTCAAGC 103 MD1122 Direct 117707 117795 89 140.9 AGUGUCGCUAUAAAUAUCUUCG UGUGUUGAAGCGACAUGAUCUU
78 GAGGCAGAGAGAGACTGAAACCACCATGGTGTTGAATCCCAGGTTGGTCTGGACGAGATTGACTACCACGGTTTTCAGTTGCACGGTGCCTC 193 MD1138 Direct 119304 119395 92 128.7 UGAAACCACCAUGGUGUUGAAU ACGAGAUUGACUACCACGGUUU
79 GAGTGGCGTTGAATCGGAGAAGTGCTCTGTTGGCGAAAACGTTCAACAGTTCGTCGGCGGCTCGGATGTTGTCTCGGCTGTTCACGGTGGTCAGAGTCCAGCTGGATGGACAACGTGTTGAGGTGTTAGCCGTCGAAGCTGCATTCTCTAGTGAGAATCGTCGTCGGTT 142 MD1154 Direct 120475 120643 169 136.4 AACAGUUCGUCGGCGGCUCGGA UCAGAGUCCAGCUGGAUGGACA
80 TCGTCGGCGGCTCGGATGTTGTCTCGGCTGTTCACGGTGGTCAGAGTCCAGCTGGATGGACAACGTGTTGAGGTGTTAGCCGTCGA 345 MD1156 Direct 120525 120610 86 115.4 UCGGAUGUUGUCUCGGCUGUUC UCCAGCUGGAUGGACAACGUGU
81 GGGTTTTCATGGGATGCGGCCGCTTTTTGATTATCTGGGACCTGATCTTTATGATCAAGGCGGGCCGCGCTCGATGTTTTTTCC 323 MD1162 Direct 121049 121132 84 116.7 AUGCGGCCGCUUUUUGAUUAUC UAUGAUCAAGGCGGGCCGCGCU
82 AGTGTTTGTAGAAGTTGGGATAGCTCTCGTTGAGTACTTCGTGTAGAGCAGTGCTAACGAGCATGTCGTCGTTAGTAGTGCGGTTCATGAGGCAGAGGGAAGCGTTCTCATCTTCTTTCAGACTGGCT 65 MD1179 Direct 122394 122521 128 147.0 UAACGAGCAUGUCGUCGUUAGU UUAGUAGUGCGGUUCAUGAGGC
83 GCAAACAGCGTTTAGTGAGTGCCAGGTTTTCTACGCAGCTCAAAACGATACATAAGGTGAATTGCTTGAGATTGCTGGGGCGGATCACGGCACAACGATGTTTAATGC 198 MD1184 Direct 122736 122843 108 127.8 CCAGGUUUUCUACGCAGCUCAA UGAAUUGCUUGAGAUUGCUGGG
84 TTGGCCACGGTGCGGTTATCGTCAACGGAGAAAGGGCAGAAAGATACTTCTTGAGCTTTTTTGACTGCTTCGATAATCGAGAGGTGGTTGA 257 MD1195 Direct 123507 123597 91 121.4 AAAGAUACUUCUUGAGCUUUUU AGCUUUUUUGACUGCUUCGAUA
85 CGAGTTCCTTGTGTGGACAAAATTCCGTTTTTTCCGTTCCGTGTGCTTTTAATTACAGGTACGGCGGGAGCGGGGAAGACGTCCAGTATTCAGGTTCTCG 196 MD1223 Direct 125058 125157 100 128.1 CCGUUUUUUCCGUUCCGUGUGC CGGCGGGAGCGGGGAAGACGUC
86 GTTTTCTGCCATGTATCTGTTTTATACTTCTTCTTTCGCCACTGAAGAGATTCTTCGGGAGATCTCGCGGATTGAGCTGCCGGATATTTCCTCTCTCTGTGGAGGAGTGGAAGAGGTTAGCACGATGCCCGAGAATGTGGTGGAAGAT 70 MD1234 Direct 126470 126617 148 146.4 AUCUGUUUUAUACUUCUUCUUU CGGAUAUUUCCUCUCUCUGUGG
87 TGTGGTGGAAGATGTGTACGACATCCCATGTCTATCGTCTGAAGATGGGTATCACGATGAGGTGTCGGACACGGATCTTCTGACTAACA 228 MD1236 Direct 126605 126693 89 124.2 UGUGUACGACAUCCCAUGUCUA UGAGGUGUCGGACACGGAUCUU
88 CTCTTTCGTAGGTATGTTGTCGAATGTATCCCCTGCTCAAACGTATACTTTAGAAGGTTATACGAACGATAACGTTTTGAGTTTACCTGGAGAGAG 254 MD1243 Direct 126926 127021 96 121.4 UAUGUUGUCGAAUGUAUCCCCU AAGGUUAUACGAACGAUAACGU
89 ATGATGATGATCATTGAGACATCTCGCCGAATGCATGTCGTCGATCGTTAGTTAGTATTATCGTCGAGAATTGTACTCAAGGTGACGCTTAGTATCTATCAATCAT 98 MD1280 Direct 129222 129327 106 142.0 AUCGUUAGUUAGUAUUAUCGUC UCGUCGAGAAUUGUACUCAAGG
90 TGTCGATTGATATCACGGAAGACAATGTGTTACGGGACAGCTTGTTTCTCCGCGGTGGAGTCGTTTTTAATAAGTCTGTGTCCTCTGTGGTGGGAAGCGGCGAGGCTGGTCCGGCGTTGTTGACGATGATTTCAGAGTCCGGCA 116 MD1314 Direct 131136 131279 144 139.1 CAGCUUGUUUCUCCGCGGUGGA UGUCCUCUGUGGUGGGAAGCGG
91 CGATTGATATCACGGAAGACAATGTGTTACGGGACAGCTTGTTTCTCCGCGGTGGAGTCG 217 MD1315 Direct 131139 131198 60 125.1 AAUGUGUUACGGGACAGCUUGU CUUGUUUCUCCGCGGUGGAGUC
92 GGGATGGCAGGACTTTAACACTAGATGCTTAGTCTTATCGATTAAGTACTCGCGGGTTTGGGCTTCAGCTCCCC 344 MD1330 Direct 132495 132568 74 115.5 UUAGUCUUAUCGAUUAAGUACU UUAAGUACUCGCGGGUUUGGGC
93 GGGTCCTGTCCTACAATGATAACGCGTACCGATTGGGGTTCGTTCAAGTGACTCCAACGGTGGACGTGTTCAGGTGCGGGATAAATGGTCTC 117 MD1331 Direct 132862 132953 92 139.1 AACGCGUACCGAUUGGGGUUCG CUCCAACGGUGGACGUGUUCAG
94 ATTCCGGTTTTAGGAATGGGAATTCGGATAGGGCGGCCCATTTTGCTATCTTCGTTTCTAGCTCCTAGCAAAACCGCGAAT 260 MD1336 Direct 133292 133372 81 121.1 UUUAGGAAUGGGAAUUCGGAUA UAUCUUCGUUUCUAGCUCCUAG
95 TGGAACCCTGGTGCTGTTAACAGTGACGTTTGTGGTGCCGCTGGAACCGGTGGTATTTGTAGATACACTTATGGACTCGGTGGTTGCA 159 MD1349 Direct 134322 134409 88 133.7 UGCCGCUGGAACCGGUGGUAUU UAUUUGUAGAUACACUUAUGGA
96 TCATATTGGAGGATGTTTTGCCGGTGCTGGAAGCAGTAGTAGTGGTCATGGGTGTGGAAGCGTGGGTTGAACTAGAGTTAGTACCAGTGTTGCTACTTCTAATTTCGCTGACGCTACTAGTGCTCGTGGTATTGGCGGAGATGTGGGTC 177 MD1351 Direct 134516 134661 146 130.8 UUUGCCGGUGCUGGAAGCAGUA UCGUGGUAUUGGCGGAGAUGUG
97 CATGGGTGTGGAAGCGTGGGTTGAACTAGAGTTAGTACCAGTGTTGCTACTTCTAATTTCGCTGACGCTACTAGTGCTCGTG 31 MD1352 Direct 134562 134643 82 158.8 AGCGUGGGUUGAACUAGAGUUA CUACUUCUAAUUUCGCUGACGC
98 GTTAGTACCAGTGTTGCTACTTCTAATTTCGCTGACGCTACTAGTGCTCGTGGTATTGGCGGAGATGTGGGTCGTGGCAGTAGCGGTGCTAGC 46 MD1353 Direct 134592 134684 93 151.4 CUACUUCUAAUUUCGCUGACGC UGGCGGAGAUGUGGGUCGUGGC
99 TCAGCGTAGCACGCGGATCGTGGAACCACATCGGTCACATTACGGAGTAGGTCCCCGCGGTCTTCGTGGCGTTTGA 174 MD1359 Direct 134919 134994 76 131.4 ACGCGGAUCGUGGAACCACAUC UAGGUCCCCGCGGUCUUCGUGG
100 TGGCAGATTTTAGATACTGAAAAGAGTTACCACATGATGCGTTGACTTGTATCTGTACGTGGGTCGAGTCGTGTGTCTGTAGAAGTTTTCCA 189 MD1363 Direct 135082 135173 92 129.3 UGAUGCGUUGACUUGUAUCUGU UAUCUGUACGUGGGUCGAGUCG
101 TGGGTATATGGCCACGTCTGAATGCAGCGAGTATACAGGCACGGTGTGTACACCGTGTCGTGTCTGCAACGGATCTGGAATGACGACTATCCA 144 MD1380 Direct 136193 136285 93 135.8 CACGGUGUGUACACCGUGUCGU UGUCGUGUCUGCAACGGAUCUG
102 GATGCTGTCGGATGTTGACTCTTAGCTACTGAAGTGACGTTCAATCTTAACGTGTCGTGGTTCTAAGAGCTCCATTACGTGGATAGCGTC 160 MD1386 Direct 136943 137032 90 133.5 UGUCGGAUGUUGACUCUUAGCU UGUCGUGGUUCUAAGAGCUCCA
103 GGACGTCTTCGATTGCTGATTTCACGTTGTATGTTCTGGTGTAGTGAATCATAAACATGGCCCTGGTGGTGTTCATGGTCTTGCATTTAGCGATAGCGCTCTCGAGGACCTCGTTC 155 MD1404 Direct 138080 138195 116 134.0 UGGUGUAGUGAAUCAUAAACAU UUCAUGGUCUUGCAUUUAGCGA
104 TTGGCACGTTGCCAGCGGCATGGTCTGGTGCCAAAGGTTCAAACCATGTGATTGGCAAACGGCCAA 43 MD1438 Direct 141126 141191 66 152.7 UCUGGUGCCAAAGGUUCAAACC AAACCAUGUGAUUGGCAAACGG
105 GCCAGGAATGGGTGGTCTTTATGACTCAATGTTCTTGGCAGTACTCCATTGACGTCAATCAGCATGTGCCAAGAACATTGAGTCATAGGGACCACCTTATTTTATGTGC 25 MD1448 Direct 141943 142051 109 163.8 UCUUUAUGACUCAAUGUUCUUG CAAGAACAUUGAGUCAUAGGGA
106 GATATAAAACCGTGCCAAGTACATTGAGTCATATGGAAAGTCCCTAGTTGTTTATGCCAAATAGGGTCATGAGAACACGGAAGTACTCTAAGTGACCTTATGTTCTTGGCACGGTGTATATT 179 MD1452 Direct 142111 142232 122 130.7 UAUGCCAAAUAGGGUCAUGAGA UGAGAACACGGAAGUACUCUAA
107 GCCAAGATATAGCTGATATATTGATCCCTGCTGGCCTATGGCCAAGGTATAGCTGATACATTGATCCCTGCTGGCCTAGGGCCAAGGTATAGCTGATATATTGATCCCTGCTGGCCTATGGCCAAGGTATAGCTGATACATTGATCCCTGCTGGCCTAGGGCCAAGGTATAGCTGATATATTGATCCCTGCTGGCCTATGGC 197 MD1463 Direct 142708 142909 202 128.1 CCUGCUGGCCUAUGGCCAAGGU UGCUGGCCUAUGGCCAAGGUAU
108 GTATAGCTGATACATTGATCCCTGCTGGTCTAGGGCCAAGGTATAGCTGATACATTGAACCCTGCTGGCCTAGGGCCAAGGTATAGCTGATAC 168 MD1466 Direct 142914 143006 93 131.8 AGGUAUAGCUGAUACAUUGAAC CUAGGGCCAAGGUAUAGCUGAU
109 CATTGATCTATGTTGGCATGAGCCATTGTATCGCTGATAGTTGGCATGGTGCCAAGTGTCAGCGACAATGGCGACAGTCCACGACAGTG 93 MD1467 Direct 143006 143094 89 143.2 AUGAGCCAUUGUAUCGCUGAUA AGUGUCAGCGACAAUGGCGACA
110 GAGACATGTTATTTTGTTCGCTTGATAGTTGAGAAATATGGATGAGTACACATCGTAGAGACTACACCTTGGGTAGAATAAGCATGTCTC 269 MD1477 Direct 143921 144010 90 120.2 UGGAUGAGUACACAUCGUAGAG UAGAGACUACACCUUGGGUAGA
111 AAACACAGTCCAGAGAAAAGGCCATGTATAATCTCGAGACTTTATGTTTGGCGAGCATGTTCTAGATTTACATTTTGCCCGACATCTAATCATTAGATTTGCGGCTTCCACATTTTTCTTGAAAAGTTT 341 MD1529 Direct 147954 148082 129 115.7 AGAAAAGGCCAUGUAUAAUCUC UUGCCCGACAUCUAAUCAUUAG
112 ATTTTACAGTAAGTCTATGGTGTAACTTGACTATCCGGTTTATAATTCTTTCATTTCAATCAGTAGTTCAGTAGGTTCTCCCAAGACTTCTGTCAGAT 173 MD1542 Direct 149081 149178 98 131.6 AAGUCUAUGGUGUAACUUGACU UUCUCCCAAGACUUCUGUCAGA
113 ATTGGTAGTATTCGGTGAATTAGTTGCCGTGGATGTGTTGGTAGTACTCGATGGATTAGTTGGCGTGGATGTGTTAGTAGTATTCGGTGAATTAGTTGTCGCGGATGTGTTAGTAGTATTCGGTGAATTAATTGTCGTGGATGTGTTGGTAGTATTCGGTGAATTAGTTGTCGTGGATGTGTTAGTAGT 15 MD1555 Direct 149669 149857 189 171.5 AGUACUCGAUGGAUUAGUUGGC AUGUGUUAGUAGUAUUCGGUGA
114 ATTGGTAGTATTCGGTGAATTAGTTGCCGTGGATGTGTTGGTAGTACTCGATGGATTAGTTGGCGTGGATGTGTTAGT 241 MD1556 Direct 149669 149746 78 122.1 UUCGGUGAAUUAGUUGCCGUGG CUCGAUGGAUUAGUUGGCGUGG
115 AATTAGTTGCCGTGGATGTGTTGGTAGTACTCGATGGATTAGTTGGCGTGGATGTGTTAGTAGTATTCGGTGAATTAGTTGTCGCGGATGTGTTAGTAGTATTCGGTGAATTAATTGTCGTGGATGTGTTGGTAGTATTCGGTGAATTAGTTGTCGTGGATGTGTTAGTAGTATTCGGTGAATTAGTT 83 MD1557 Direct 149686 149873 188 145.1 GGUAGUACUCGAUGGAUUAGUU UAGUAGUAUUCGGUGAAUUAGU
116 GGTGATAGCGTAGTATTCGTAGAACCTGATGAAGCCGAAGTGGTTTGATTAGCTTCTGAGATGAAGCATGTGATTATT 178 MD1565 Direct 150237 150314 78 130.7 AGUAUUCGUAGAACCUGAUGAA GAUUAGCUUCUGAGAUGAAGCA
117 ATCGCCTCTACTTTAGGACAACCAGCAGTTGGCAGATGTCTAATTATGTATTGTGACTTTAATGGTATTTTTGTCATTAAATTGCCGGTACAGCGACATCGGAGCTCTTGAATCGTGGCTGAAGTAAATGATACGGT 320 MD1576 Direct 150803 150939 137 117.1 UUAUGUAUUGUGACUUUAAUGG UUAAAUUGCCGGUACAGCGACA
118 ACCATTTTTTTTTGTATATTGACCTTCAACATGAGCATAAATAAGAGTCTTTTTATGTATACTGCTTCTGGGTCGATGCAGACTTTGGT 141 MD1581 Direct 151232 151320 89 136.4 UAUAUUGACCUUCAACAUGAGC UAUACUGCUUCUGGGUCGAUGC
119 TGTTAGAATATGAGTATTTTTTCCATGTGAATATAGCATACCTTATATCGTTTGAAGAGGCTATATAATAATCTGATA 293 MD1593 Direct 152083 152160 78 118.9 AAUAUAGCAUACCUUAUAUCGU UAUCGUUUGAAGAGGCUAUAUA
120 TCAGGAGGGTTCTCGTAATAACAGGTATATAGACCGGTCAAGTTGTCATTCATCTTGAATTGTAATGTGATGGTCGTATAGTTACTACGAGTTGTTTTGA 38 MD1594 Direct 152187 152286 100 153.5 AUAUAGACCGGUCAAGUUGUCA UAAUGUGAUGGUCGUAUAGUUA
121 TATAGACCGGTCAAGTTGTCATTCATCTTGAATTGTAATGTGATGGTCGTATA 261 MD1595 Direct 152214 152266 53 121.0 UCAUUCAUCUUGAAUUGUAAUG AAUUGUAAUGUGAUGGUCGUAU
122 TGTAATTATTCTCACGTAGGTGGTTTTTTCGGTGTGGACGACGATGAAGGTGATCTGCGGAGTGTAGAGGCA 61 MD1603 Direct 153083 153154 72 147.2 AUUCUCACGUAGGUGGUUUUUU AUGAAGGUGAUCUGCGGAGUGU
123 TACTATTATGGTTTACAGAAGGCACAAGAGCTTGCTTTCGATTCGTTGGGGAATGCGCGACTCAATGTGTTGCCGAACACTTTTGACGTCGATGTATCGAACGGAACGGAGTATCTGATGTATGTTTTGTGCGGAATAGTA 45 MD1619 Direct 154340 154480 141 152.3 UGCGCGACUCAAUGUGUUGCCG UUUUGACGUCGAUGUAUCGAAC
124 TCAGTGTAGTGCGGCGAAATGCGGGGCGGAGTGCACGTGGCCTGCTTGTTGCAGATGTTAGCGTGTGAGAAACAGAGCACGTGTACCTAGCCCCGCTCTCGCCGGACCACGGA 84 MD1626 Direct 154835 154947 113 144.9 UGCGGCGAAAUGCGGGGCGGAG GAGAAACAGAGCACGUGUACCU
125 GGAGTGCAGACGAGAGGACAGAGTGCCCTGTCAAGTACACGTGTCTATTAGTTTGGAGACACAGTGTAGAGACAAGGTACTCAGTCCGCGTTGACATGCC 2 MD1627 Direct 154945 155044 100 185.8 AGUGCCCUGUCAAGUACACGUG CACAGUGUAGAGACAAGGUACU
126 CATGCCAGCGATCGTTCTCATGAAATCTTAATCGACATGTAGGTGAGAATATGGCAAGGGACGTTTCCATCTAAATGTCGATGTAGATGTTATGAGAAGATGCGACGATCAGGGATG 7 MD1628 Direct 155039 155155 117 183.0 UAAUCGACAUGUAGGUGAGAAU UUUCCAUCUAAAUGUCGAUGUA
127 GGTTGATAGCTGTAACAGGAGAGGTTGGGGATGAGTAAAGTGGAGGGTTATCCGCGCCTCCGGCCCTCGGATCCTTGCTGCCCTGCTCCCCCAGATCCTCCCGCACGCTCTAGTCCCCC 62 MD1636 Direct 155789 155907 119 147.1 UAUCCGCGCCUCCGGCCCUCGG UCGGAUCCUUGCUGCCCUGCUC
128 CGCGCTCGCTTTCGGGCCCGAGGCCCGCTGTCGGGCGCGCTTTCGGGCCCGATTCCCGCTTTCGGGCCCGCTTTCGGGCGCG 327 MD1646 Direct 156658 156739 82 116.4 UCGGGCGCGCUUUCGGGCCCGA GGCCCGAUUCCCGCUUUCGGGC
129 GGTGTGTGGTGACGGCCGGGCGGCCGAGCGCGCTGTGTGGTGGCGGCCGGGCCGGGCGAGCGCGCT 214 MD1655 Direct 156930 156995 66 125.2 CCGAGCGCGCUGUGUGGUGGCG UGGCGGCCGGGCCGGGCGAGCG
130 GGCGCTCGCCGCTCCCCCCCGGAAGCGCGTGGCGCCGCCTCGCCTGGCGTTTTGTGCGTGTGAGGCGGCGCGGCGGGCCTTTCGGCGCTCGGGAGCTCGCGCGCGCC 40 MD1658 Direct 157125 157231 107 153.4 AAGCGCGUGGCGCCGCCUCGCC UGUGAGGCGGCGCGGCGGGCCU
131 GACGGCCGCGAGACGCCGCCGGAGGCCGAGGCGAGCCCGAGGCGCCGTCGACAGCCGCCCGGACAGCCGCCCGGACAGCCGCCCGGGGAGCATGGGCGACGCGGCCCCCGGCTCGCCGGCCTCAGGGGCCTCGGGGGCGTC 281 MD1659 Direct 157249 157389 141 119.6 CGAGGCGAGCCCGAGGCGCCGU GACGCGGCCCCCGGCUCGCCGG
132 CAGGGGCCTCGGGGGCGTCAGCGCCGCCAGCGCCGCCGGCGCCGCCTCGCGCCGACACCCCCGGGCCCGAAAGCGGCCCCCCCCTGGGGCTCCCGCCGGGCCTGCCGGCGCCGGGCCTCGCCGCGGCCCCCGCCACCGCCGCCAACGCCGCCGCCTGGTGCTCCTG 127 MD1660 Direct 157371 157536 166 138.1 UCAGCGCCGCCAGCGCCGCCGG UCCCGCCGGGCCUGCCGGCGCC
133 GATGAGCGGCGGCGCGGAGCCGGGGCGGCTGTCGGCTGGAGCGGCCGCTCCGTCCGCTCCGTCCGCGGCGTC 135 MD1687 Direct 158938 159009 72 137.6 GGCGGCGCGGAGCCGGGGCGGC CCGCUCCGUCCGCUCCGUCCGC
134 CCACGCGGCGCTGGTGCCAGCGCGAGCAGGGCGGCGTGCTGCCCCTGGGCCGGCCTCACGGGTTCTTCGCCGTGGTGACTCCGCGCTCGCAGATGCCCGGCGTGG 256 MD1690 Direct 159117 159221 105 121.4 CUGGGCCGGCCUCACGGGUUCU CGGGUUCUUCGCCGUGGUGACU
135 GCCGACGAGTTCTTCCGCTTCGGACTGGGCGGCGTGTCGCGGCTGTACGCGTGCGACCTGCTGCCCCGCAGCACGACGGAGCCGGCGCGGC 163 MD1697 Direct 159464 159554 91 133.0 UGUCGCGGCUGUACGCGUGCGA UGCGACCUGCUGCCCCGCAGCA
136 TGTACGCGTGCGACCTGCTGCCCCGCAGCACGACGGAGCCGGCGCGGCTGAGCGAGGCGCTGGCGGCCGCCAGCCGCGCGGCGCACGCGGCGCACGCGGTGGCGGAGGCGCACGCCGGACA 51 MD1699 Direct 159507 159627 121 149.6 GAGCCGGCGCGGCUGAGCGAGG GCCGCCAGCCGCGCGGCGCACG
137 CGACGGAGCCGGCGCGGCTGAGCGAGGCGCTGGCGGCCGCCAGCCGCGCGGCGCACGCGGCGCACGCGGTGGCGGAGGCGCACGCCGGACACGAACTGCAGCTGGTGACGCCG 208 MD1700 Direct 159537 159649 113 126.0 AGCCGGCGCGGCUGAGCGAGGC ACGCGGUGGCGGAGGCGCACGC
138 CGCCGGGCCGGCCGGCGCAGACGGCGGTGCTGTGGCCGCGCTGGTCTGACCTGCGGAACGTGTGGCCCTTCTGCTCGCACGCGCGGCCGGCCGAGCTGGTG 182 MD1702 Direct 159645 159745 101 130.3 GGCGGUGCUGUGGCCGCGCUGG CGUGUGGCCCUUCUGCUCGCAC
139 TCTGCTCGCACGCGCGGCCGGCCGAGCTGGTGGAGGCGGCCCGGCGCCACGTGACGCAGCGGCTGTGCTGCGCCTGGTACCCGCTGGCCGTGGTGCTGAGCAACCTGCCGAAGGAGTCGATCGCGCGCGTGCCGCTGG 154 MD1703 Direct 159714 159851 138 134.1 CGCCACGUGACGCAGCGGCUGU ACCCGCUGGCCGUGGUGCUGAG
140 TGCTCGCACGCGCGGCCGGCCGAGCTGGTGGAGGCGGCCCGGCGCCACGTGACGCAGCGGCTGTGCTGCGCCTGGTACCCGCTGGCCGTGGTGCTGAGCA 80 MD1704 Direct 159716 159815 100 145.4 CGAGCUGGUGGAGGCGGCCCGG CAGCGGCUGUGCUGCGCCUGGU
141 AGCAACCTGCCGAAGGAGTCGATCGCGCGCGTGCCGCTGGTGGCGCTGCTGGACGAGCTGTGCGCCGTGTGGGCGTACTGCACGCTGGACGGGCAGCTGTACCCGCTGGCCGACGACCTGGGGCACCTGCT 96 MD1706 Direct 159812 159942 131 142.7 UGUGCGCCGUGUGGGCGUACUG UACUGCACGCUGGACGGGCAGC
142 GCTGTGCGCCGTGTGGGCGTACTGCACGCTGGACGGGCAGCTGTACCCGCTGGCCGACGACCTGGGGCACCTGCTGCGCGCCGGCACGCTGTCGCTGCTGCACCTGGGCCGCACGGC 234 MD1707 Direct 159868 159984 117 123.2 ACGCUGGACGGGCAGCUGUACC UGGGGCACCUGCUGCGCGCCGG
143 TCCAGGGCCTGGCGGCGGGCGCGGGCGCCGTGGGCGGCGGGCGCAGCGGCGAGCGCGACGCCGGGCTGCGGGCCCGCGACGCCGAGCTCCTGGG 85 MD1713 Direct 160146 160239 94 144.9 GGCGCGGGCGCCGUGGGCGGCG ACGCCGGGCUGCGGGCCCGCGA
144 CGGGCGCCGTGGGCGGCGGGCGCAGCGGCGAGCGCGACGCCGGGCTGCGGGCCCGCGACGCCGAGCTCCTGGGCCTGCCGGGGCTGTGCCAGCGCTCGCCGCCCCGCAGCCCGGCGGCGGCGCTGTCGCACGCGCTGCGCCACGACCGCGACCGCTGGCGGCCG 71 MD1714 Direct 160167 160330 164 146.4 CGUGGGCGGCGGGCGCAGCGGC CACGACCGCGACCGCUGGCGGC
145 TGGGCGGCGGGCGCAGCGGCGAGCGCGACGCCGGGCTGCGGGCCCGCGACGCCGAGCTCCTGGGCCTGCCGGGGCTGTGCCAGCGCTCGCCGCCCCGCAGCCCG 16 MD1715 Direct 160176 160279 104 171.4 CGCCGAGCUCCUGGGCCUGCCG CAGCGCUCGCCGCCCCGCAGCC
146 GTGGCCGCCCGGCGGCTGAGCAAGTTCCGCGCGCGCGACTCGCGCGAGCTGCTGCGGCCGCTGCCGCGGCCGC 131 MD1718 Direct 160412 160484 73 137.7 CCGGCGGCUGAGCAAGUUCCGC CGAGCUGCUGCGGCCGCUGCCG
147 GTTCCGCGCGCGCGACTCGCGCGAGCTGCTGCGGCCGCTGCCGCGGCCGCCGCTGGAGACGACGCCGGAGC 278 MD1719 Direct 160435 160505 71 119.7 UGCUGCGGCCGCUGCCGCGGCC CCGCCGCUGGAGACGACGCCGG
148 CCGCGGCCGCCGCTGGAGACGACGCCGGAGCCCCCCATCGCCGCGGCGCCGTCAACGTCGTCTGCGGCGGCGGCCGCGG 157 MD1720 Direct 160475 160553 79 133.8 CCGCCGCUGGAGACGACGCCGG ACGUCGUCUGCGGCGGCGGCCG
149 CGACGCCGGAGCCCCCCATCGCCGCGGCGCCGTCAACGTCGTCTGCGGCGGCGGCCGCGGAGAGCCCGGCCGGCTCGGGGGCCGAAGCCGGGGACGACGCCGACGACGCCGCGGCCAGCCGCGGAGAGGGCGCCGGCGGCG 122 MD1721 Direct 160494 160634 141 138.7 CCGGAGCCCCCCAUCGCCGCGG GGGACGACGCCGACGACGCCGC
150 GCCGACGACGCCGCGGCCAGCCGCGGAGAGGGCGCCGGCGGCGAGGTCCGCGGCCACGCCGGCGGCCAAGGCGGCCAGGGCGGCGGCGGCGGCGGC 315 MD1723 Direct 160592 160687 96 117.4 CGAGGUCCGCGGCCACGCCGGC CCGGCGGCCAAGGCGGCCAGGG
151 GGCGGCCAGGGCGGCGGCGGCGGCGGCCACGGCGCCCAGGACAGCCAGCAGCCGGCCGGCGGCGGCCCCTGCGGCGCGGCCCTGGCCGGGCCCTGCTGCTGCGACTGCAGCTGCC 67 MD1725 Direct 160661 160775 115 146.8 AGCCGGCCGGCGGCGGCCCCUG GGCGGCCCCUGCGGCGCGGCCC
152 GCCGCCCGCCGCCGTGCAGAGCGCCCGGCAGCTGGGCGCCGCCTGGCGCACGCTGAGCCGCGAGGCGCGCCAGGCGCGAGAGGCGCGCCAGGCGGCGGCGGGCGGGGGCGCGGGAGGGCCGGGAGCGGGTGCGGGTGCGGGTGCGGGCGGC 329 MD1728 Direct 160789 160939 151 116.4 GCGCACGCUGAGCCGCGAGGCG AGGCGCGCCAGGCGGCGGCGGG
153 GGTGCGGGTGCGGGCGGCGGCGGCCTCTGCGGCGGCGTCCAGCGCATGGCGCTGAGCCTGCCGGGCCGCGAGTGCCAGACGCGCT 219 MD1731 Direct 160922 161006 85 124.7 GGCGGCGGCGGCCUCUGCGGCG CAUGGCGCUGAGCCUGCCGGGC
154 GGTGCGGGCGGCGGCGGCCTCTGCGGCGGCGTCCAGCGCATGGCGCTGAGCCTGCCGGGCCGCGAGTGCCAGACGCGCT 248 MD1732 Direct 160928 161006 79 121.6 CGUCCAGCGCAUGGCGCUGAGC UGAGCCUGCCGGGCCGCGAGUG
155 CGTGGTCGCCGCAGCAGCGGCCGCGGCAGCAGCAGCCGCAGCAGCAGCGGCGGCAGCAGCAGCCGCGGCCGAAGGAGCAGCAGCCGCG 167 MD1741 Direct 161585 161672 88 131.9 AGCGGCCGCGGCAGCAGCAGCC CGGCAGCAGCAGCCGCGGCCGA
156 GCCGAAGGAGCAGCAGAAGCAGAAGCGGAAGGCGAGGGCGACGTCGAGCGCACGTTCAGAGATGAATCCGCTAACTCTTCTTCGCACTGCTTCGGTTGCTTTTCTTTTTGTTTTTTTGGC 101 MD1742 Direct 161673 161792 120 141.8 CAGCAGAAGCAGAAGCGGAAGG CCGCUAACUCUUCUUCGCACUG
157 GAAGGAGCAGCAGAAGCAGAAGCGGAAGGCGAGGGCGACGTCGAGCGCACGTTCAGAGATGAATCCGCTAACTCTTCTTCGCACTGCTTCGGTTGCTTTTC 137 MD1743 Direct 161676 161776 101 137.5 AAGCGGAAGGCGAGGGCGACGU UUCGCACUGCUUCGGUUGCUUU
158 GCATTGAGTATATCGCAACGAATGCCAGATGGTATATTGAGTAATATACGCGTCCAGGAGATATAGAAAACTACTGACGATGATGTTCAACTGTTCTGTCTCATTCGGCGCAGTAGTCTTTGT 233 MD1797 Direct 167388 167510 123 123.4 UCGCAACGAAUGCCAGAUGGUA UACUGACGAUGAUGUUCAACUG
159 GGAGCCCCAAGGAAATTCAAAATAATTCGGAAAAGAGACTTTAGGGACAGGACACTGGTAACGCCACATGAGTTGTGCTCGAATAACTCGGTGTTTCCAAGCCTCCTTCTCGAGAGTGACTTCTTCCCAGTTGGCCGTATCGTGTTTTTGGAGTTCT 56 MD1818 Direct 170292 170448 157 148.7 GGAAAAGAGACUUUAGGGACAG CGGUGUUUCCAAGCCUCCUUCU
160 GATGTCCCTGTGGCGCGACGAAGAGCTTGATGAACCGTATCGCGATAAGCGATTTCTGATTGAGAAACGCCGTATCTCGCTAATTCGTCAAGATGATGAGCCACCAGCAACAGACATT 89 MD1866 Direct 174809 174926 118 143.9 AACCGUAUCGCGAUAAGCGAUU CGCCGUAUCUCGCUAAUUCGUC
161 ACTCACGTTGTCATGACTAAACTTCCTCGTCAAAGAGTATGGTCGAATGTAGTGCTGCGATCTGCATTTTTCGCTATCGGGCTGGAGACTAGTTTAGTCATGGTTCGCATTCTGAGT 332 MD1947 Direct 181569 181685 117 116.1 UUGUCAUGACUAAACUUCCUCG UUUAGUCAUGGUUCGCAUUCUG
162 GACGACAGGAGCGCTGATAATCATCGTACTATACTTGTTCAGCTCATGGAACGACTATATCTTGGTGGTTGGTTGCATTTTTTTGATC 230 MD1949 Direct 181802 181889 88 123.8 AUAAUCAUCGUACUAUACUUGU ACGACUAUAUCUUGGUGGUUGG
163 GGCATGTCCAGTAGTCTCATTTGTATGTCGAAAGTCTATACATCATACGCATTACGAATCATTATGATCGATTATGTACACGCTTTTCTGATTTACTGGTCAACTATCTGGATAGTC 145 MD1961 Direct 182500 182616 117 135.5 GAAAGUCUAUACAUCAUACGCA AUCGAUUAUGUACACGCUUUUC
164 TGCTCACAATCTGTATTTTGGAGGAATGTCGATGTACTATGGAATTCTGTTATTAAAATATGGTTGGCA 351 MD1982 Direct 184624 184692 69 115.1 CAAUCUGUAUUUUGGAGGAAUG AAUUCUGUUAUUAAAAUAUGGU
165 GATGCAGGGATGGAGTCCGTTGAAGATTGTTTTGTATATCTGGGGGCAACTAGTGTTTTGGGTAATCTTGCTTTATCTAGTATC 227 MD2080 Direct 192667 192750 84 124.2 UCUGGGGGCAACUAGUGUUUUG UUUUGGGUAAUCUUGCUUUAUC
166 TCGGGCGGCTGACGGCGCCGGAGCGGCGCGGCGACTGGCAGCAGCAGCAGCAGCAGCAGCGGCGGCAGGAGGAGCTGTAGCCGCCCGG 223 MD2085 Direct 193234 193321 88 124.4 CAGCAGCAGCAGCAGCAGCAGC CAGGAGGAGCUGUAGCCGCCCG
167 GCGGCGGGCGGCCCGCGGGCCGGGTGGCAGCTGCAGTCGCAGCAGCAGGGCCCGGCCAGGGCCGCGCCGC 308 MD2094 Direct 193994 194063 70 117.8 GGCGGCCCGCGGGCCGGGUGGC AGGGCCCGGCCAGGGCCGCGCC
168 CCGCAGGGGCCGCCGCCGGCCGGCTGCTGGCTGTCCTGGGCGCCGTGGCCGCCGCCGCCGCCGCCCTGGCCGCCTTGGCCGCCGGCGTGGCCGCGG 113 MD2096 Direct 194060 194155 96 139.2 GCCGUGGCCGCCGCCGCCGCCG CUUGGCCGCCGGCGUGGCCGCG
169 GCAGGGGCCGCCGCCGGCCGGCTGCTGGCTGTCCTGGGCGCCGTGGCCGCCGCCGCCGCCGCCCTGGCCGCCTTGGCCGCCGGCGTGGCCGCGGACCTCGC 75 MD2097 Direct 194062 194162 101 145.8 UGCUGGCUGUCCUGGGCGCCGU CGCCGCCCUGGCCGCCUUGGCC
170 CGCCGCCGGCCGGCTGCTGGCTGTCCTGGGCGCCGTGGCCGCCGCCGCCGCCGCCCTGGCCGCCTTGGCCGCCGGCGTGGCCGCGGACCTCGCCGCCGGCGCCCTCTCCGCGGCTGGCCGCGGCG 194 MD2098 Direct 194070 194194 125 128.7 UGGCCGCCUUGGCCGCCGGCGU CGGCGCCCUCUCCGCGGCUGGC
171 GGACCTCGCCGCCGGCGCCCTCTCCGCGGCTGGCCGCGGCGTCGTCGGCGTCGTCCCCGGCTTCGGCCCCCGAGCCGGCCGGGCTCTCCGCGGCCGCCGCCGCAGACGACGTTGACGGCGCCGCGGCGATGGGGGGCTCCGGCGTCGTCTCC 20 MD2100 Direct 194154 194305 152 168.8 CUGGCCGCGGCGUCGUCGGCGU AUGGGGGGCUCCGGCGUCGUCU
172 GCCGGCCGGGCTCTCCGCGGCCGCCGCCGCAGACGACGTTGACGGCGCCGCGGCGATGGGGGGCTCCGGCGTCGTCTCCAGCGGCGGCCGCGGCAGCGGCCGCAGC 6 MD2101 Direct 194227 194332 106 183.1 GCGGCCGCCGCCGCAGACGACG GCGGCCGCGGCAGCGGCCGCAG
173 GCTCGCGCGAGTCGCGCGCGCGGAACTTGCTCAGCCGCCGGGCGGCCACGTCCTCGGGCCGCGACGCGCCGCGCGGGTACTCCTGCGGGT 95 MD2103 Direct 194334 194423 90 142.9 GGGCGGCCACGUCCUCGGGCCG UCGGGCCGCGACGCGCCGCGCG
174 GCCCGCGTCGGCCGCCAGCGGTCGCGGTCGTGGCGCAGCGCGTGCGACAGCGCCGCCGCCGGGCTGCGGGGCGGCGAGCGCTGGC 36 MD2104 Direct 194456 194540 85 154.9 CAGCGGUCGCGGUCGUGGCGCA ACAGCGCCGCCGCCGGGCUGCG
175 GCGGTCGCGGTCGTGGCGCAGCGCGTGCGACAGCGCCGCCGCCGGGCTGCGGGGCGGCGAGCGCTGGCACAGCCCCGGCAGGCCCAGGAGCTCGGCGTCGCGGGCCCGCAGCCCGGCGTCGCGCTCGCCGCTGCGCCCGCCGCCCACGGC 63 MD2105 Direct 194473 194622 150 147.1 CAGCGCCGCCGCCGGGCUGCGG AGCUCGGCGUCGCGGGCCCGCA
176 GCAGCTGCTGGTGCGCGCGCGGGTGCAGGAACAGCGCGTCGGCGCGCGGCGTCTCCCAGAACTCGCGGTCCACCGGCGGCAGC 285 MD2107 Direct 194694 194776 83 119.4 CAGCGCGUCGGCGCGCGGCGUC AGAACUCGCGGUCCACCGGCGG
177 GCGTGCGCCTCCGCCACCGCGTGCGCCGCGTGCGCCGCGCGGCTGGCGGCCGCCAGCGCCTCGCTCAGCCGCGCCGGCTCCGTCGTGCTGCGGGGCAGCAGGTCGCACGC 19 MD2113 Direct 195173 195282 110 169.1 GCCGCGUGCGCCGCGCGGCUGG CUCAGCCGCGCCGGCUCCGUCG
178 GCGGCTGGCGGCCGCCAGCGCCTCGCTCAGCCGCGCCGGCTCCGTCGTGCTGCGGGGCAGCAGGTCGCACGCGTACAGCCGC 186 MD2114 Direct 195211 195292 82 129.8 CGCCGGCUCCGUCGUGCUGCGG UGCUGCGGGGCAGCAGGUCGCA
179 GGCGTCGCGGGCCGCCAGGTGCAGGGTCAGTCGCGCCAGGTCCAGCAGGAACACGCGGAACCGCGGACCCACGCCCAGGTACAGGCCGTCCGTGCGGCACC 347 MD2116 Direct 195328 195428 101 115.3 AGGGUCAGUCGCGCCAGGUCCA AACCGCGGACCCACGCCCAGGU
180 GGTACAGGCCGTCCGTGCGGCACCAGCCGTCCGACGTCCACGGCGAGCGCGCCTCCAGCCGGGCGGCGTGGGCGCGGTCCTGAGCCGCCGACGGCACGGCGTGCACC 69 MD2117 Direct 195405 195511 107 146.8 CGUCCGACGUCCACGGCGAGCG CGGCGUGGGCGCGGUCCUGAGC
181 CGAGGCCCCGCCGCCGGCACGCGCCCTCGCGAGAGTCTTCCCGCTCTGTCCGGTCACAGGCACCTAGGGCACACGGAGGTGGTGGACGTCTTAGGGCAAGGGCGGCGCGGAAGGCCCG 298 MD2126 Direct 195997 196114 118 118.5 CGAGAGUCUUCCCGCUCUGUCC ACACGGAGGUGGUGGACGUCUU
182 CAGGGGCCTCGGGGGCGTCAGCGCCGCCAGCGCCGCCGGCGCCGCCTCGCGCCGACACCCCCGGGCCCGAAAGCGGCCCCCCCCTGGGGCTCCCGCCGGGCCTGCCGGCGCCGGGCCTCGCCGCGGCCCCCGCCACCGCCGCCAACGCCGCCGCCTGGTGCTCCTG 128 MR8 Reverse 567 732 166 138.1 UCAGCGCCGCCAGCGCCGCCGG UCCCGCCGGGCCUGCCGGCGCC
183 GACGGCCGCGAGACGCCGCCGGAGGCCGAGGCGAGCCCGAGGCGCCGTCGACAGCCGCCCGGACAGCCGCCCGGACAGCCGCCCGGGGAGCATGGGCGACGCGGCCCCCGGCTCGCCGGCCTCAGGGGCCTCGGGGGCGTC 282 MR10 Reverse 714 854 141 119.6 CGAGGCGAGCCCGAGGCGCCGU GACGCGGCCCCCGGCUCGCCGG
184 GGCGCTCGCCGCTCCCCCCCGGAAGCGCGTGGCGCCGCCTCGCCTGGCGTTTTGTGCGTGTGAGGCGGCGCGGCGGGCCTTTCGGCGCTCGGGAGCTCGCGCGCGCC 39 MR11 Reverse 872 978 107 153.4 AAGCGCGUGGCGCCGCCUCGCC UGUGAGGCGGCGCGGCGGGCCU
185 GGTGTGTGGTGACGGCCGGGCGGCCGAGCGCGCTGTGTGGTGGCGGCCGGGCCGGGCGAGCGCGCT 215 MR16 Reverse 1108 1173 66 125.2 CCGAGCGCGCUGUGUGGUGGCG UGGCGGCCGGGCCGGGCGAGCG
186 CGCGCTCGCTTTCGGGCCCGAGGCCCGCTGTCGGGCGCGCTTTCGGGCCCGATTCCCGCTTTCGGGCCCGCTTTCGGGCGCG 326 MR23 Reverse 1364 1445 82 116.4 UCGGGCGCGCUUUCGGGCCCGA GGCCCGAUUCCCGCUUUCGGGC
187 GGGTGTGTGGAGGTGTGTGGCTGGTGATGAGGTGGAAGTGGTGGCGGGCAATGGTGTTCATGTTGGTGTGGGTAATGGTGCTGTTGATGCAGTTGTGGCCATCATCAGCTGGCGAGTATTTGTGGAGCCT 305 MR46 Reverse 3634 3763 130 118.2 UGUGUGGCUGGUGAUGAGGUGG UGUGGCCAUCAUCAGCUGGCGA
188 GTCTCATGGTTGTGTACTGCAGGAGTCTGTGTGGGACAGTTGGTTGTTGCTCAATATGGAAGATGTAATGCGGCTGGAGAT 200 MR50 Reverse 3826 3906 81 127.6 UACUGCAGGAGUCUGUGUGGGA AAUAUGGAAGAUGUAAUGCGGC
189 GGTGTCAGTACCGGGCTGTCGTTCTATAGATGCTGTATTTTCAAGATCAAGGATTTGTGAAGCGTCCGTGTTGGGTGGCATC 319 MR66 Reverse 4605 4686 82 117.1 GGGCUGUCGUUCUAUAGAUGCU CAAGGAUUUGUGAAGCGUCCGU
190 ATAAACGCTGGGAACATAAGGCTTTGGGAGGCATGTTTTTAGTTTACGTCGGTATGTACTCGTCATGGTAATACAGGAGATTAGGATGAGTAAGGGAAGGTACATCAGATGTGGAAAGGGTGTGTTACAATAATCAACCGACCAGGTGTTTCGACAGGTTTGT 335 MR78 Reverse 5457 5619 163 116.0 UACGUCGGUAUGUACUCGUCAU GACCAGGUGUUUCGACAGGUUU
191 GTAACAAATATGTGAACAGAAGGCGATTAGAGATTTACGTTGTTTGGACGTTAGGGCGGGATCCGCTGTGATAAGGCGGCGAATGCTAGAGTTGAGAGCCACTATTTTGTTTACAGTTAAATGCTTGTTGC 199 MR81 Reverse 5690 5820 131 127.7 GGCGGGAUCCGCUGUGAUAAGG GUUGAGAGCCACUAUUUUGUUU
192 ATCTTCCCCTGGAGTAACAAATATGTGAACAGAAGGCGATTAGAGATTTACGTTGTTTGGACGTTAGGGCGGGAT 249 MR82 Reverse 5759 5833 75 121.6 AGUAACAAAUAUGUGAACAGAA UACGUUGUUUGGACGUUAGGGC
193 CTACGATTGTTAGCAGAGTGTAACGTGACAGAGATACGTCTGTGGGCGGTAGTCGACAGGTATGCTTAATAACGTCACAGTGTGCACATGTAGATAGTTTTAG 205 MR91 Reverse 6067 6169 103 126.7 UAACGUGACAGAGAUACGUCUG CAGUGUGCACAUGUAGAUAGUU
194 CGATTTCGGCCACGGTCTCTGTGCCTGTGATGTCGACATCGACGCCGCGTCGAGGTTCTCGCGGAGCCAACGGGGGCACAGTGGGTGAGCG 140 MR122 Reverse 8306 8396 91 136.6 GGCCACGGUCUCUGUGCCUGUG AGGUUCUCGCGGAGCCAACGGG
195 CTTCGCTGAGGGGGGAGGAGCGCTATTTTGATTTTTGAATAAATTATTTTAAACCACGTAATGGTGAAATTCGATCGTCTTATGAAG 306 MR123 Reverse 8409 8495 87 117.9 AGCGCUAUUUUGAUUUUUGAAU UAAACCACGUAAUGGUGAAAUU
196 GGCGGGAGAAAATCACAGCGATTAAAACGTGTGGCGCGAATTCTTTTTGCGCGGGATTTCTCCGGGCGGGAATCCGTAAGTTGGCGCCGCGCCGTTAGCGCCGTGCAACTGTCTTCGCT 176 MR125 Reverse 8489 8607 119 130.8 UGUGGCGCGAAUUCUUUUUGCG UUGGCGCCGCGCCGUUAGCGCC
197 GTGACTCGGGTGCGGTCGGACGGCGTCGGTCTGTGTCTGTGTCCTGCTGCCGGCATGCGCAGCGACGCGGGACAGACCGGCGCTGTTCGGATCGATTCAC 22 MR127 Reverse 8634 8733 100 165.6 GGCGUCGGUCUGUGUCUGUGUC CGACGCGGGACAGACCGGCGCU
198 CCGGATCTGGGCATTTGTCCTGGCCGCTGGAATCTTCGTTGGGTGCGAAAAATTCGGGCACCGTCAGGGCGCGTTTCAGTGGATGCGG 221 MR133 Reverse 8937 9024 88 124.7 UUGUCCUGGCCGCUGGAAUCUU AAAUUCGGGCACCGUCAGGGCG
199 GGCACTTTGGAGACCGCGACTGCTGCGGGTCCGGCTGCCGTGTGGGTGGCGGCAGCTGGTCGCGAAGCAGTGGCGGTCCCATGCC 47 MR134 Reverse 9096 9180 85 150.2 GACUGCUGCGGGUCCGGCUGCC GCAGCUGGUCGCGAAGCAGUGG
200 GGCGTTTGGGTGGGAGTGGGGGTGGGGGCGGGCTGTCTCGTTCGGGGTCGGATTCCTCCTCTTCGGACGCC 300 MR137 Reverse 9254 9324 71 118.5 GGGGCGGGCUGUCUCGUUCGGG UCGGGGUCGGAUUCCUCCUCUU
201 AGTGCCGTTCTTGGAAGTCGTCTGTACACAACTGCACGCTAGTGTTTAGGCTGTGGTAACTGAACACTAAAGTACAGTAGTGTGCAGGTCGGTTCCATAGCAGGAATTGCAACT 1 MR141 Reverse 9550 9663 114 223.7 UACACAACUGCACGCUAGUGUU UGAACACUAAAGUACAGUAGUG
202 GTTTATTGACATGTTATGAAACCATGAAGTGTGTACAATGAATTGACGTTGTTAATCATGATATAAAGCTTCAGTAGATTCATGATGTTGGCGATGAAC 76 MR164 Reverse 10828 10926 99 145.7 UGAAUUGACGUUGUUAAUCAUG CAUGAUAUAAAGCUUCAGUAGA
203 GTGGTTCAGTAATATTTGGAGTTGTTTGGAAAATATGGAGGGATCGTGTTAATATTCCTAGAATTCGTTTATGGCGTTAAATAAAGTTTTACAAATTAAGTAATAACACGAGTTTTTGTTTTTTAAATCGTTTATTGACATGTTATGAAACCAT 216 MR165 Reverse 10902 11055 154 125.1 UGUUAAUAUUCCUAGAAUUCGU UAACACGAGUUUUUGUUUUUUA
204 TAAATCAGCCAACATGATGATGTAGATCGGAAAGCCATAATGTAAATAAGAATGTGTGATTGCAGTTGTTTTTGAATCAGATGTCGTCTTATATATTCTGGTTAAGATTTAGGTGCTTGCTGGATTTA 119 MR182 Reverse 11982 12109 128 139.0 UAAUGUAAAUAAGAAUGUGUGA AAUCAGAUGUCGUCUUAUAUAU
205 GGAATGATACATAATTACTTTGAGGATGAATGTGTAGAATGGATTTCACGTTATACTGGTAACAGTGGAGGACATTTTATAATTAGTCAACCTAAAACCAAAGTAGTTAAACAAAGACTTTCC 158 MR190 Reverse 12613 12735 123 133.7 AUACAUAAUUACUUUGAGGAUG AGUGGAGGACAUUUUAUAAUUA
206 GAAGGTCACTCATTAGAGTATTATCACACATTAGTCAGCCATGTTAACGGGACCCCGCATTTTTTCATTCAAGTTGGTTATGTGGATGATACTCCAATAATGGGATTTAATTC 239 MR193 Reverse 13040 13152 113 122.3 AGAGUAUUAUCACACAUUAGUC UUAUGUGGAUGAUACUCCAAUA
207 TGGTTAGTGATGTGGGGCTATACATATATACATATATATTTGTATATATGTATATATATACAAATATATATGTATATAATGTAGCGGAAGGTCACTCATTA 12 MR194 Reverse 13138 13238 101 173.1 CAUAUAUACAUAUAUAUUUGUA ACAAAUAUAUAUGUAUAUAAUG
208 GTGGATGATTCTGTTACAGTGACTTTACGTGATGATGAAGATTAAGTGTTTTCATAATTTCTAATAAAGTACAAATGTACACAGTTTCACAGTTTCAC 302 MR201 Reverse 13929 14026 98 118.3 UGAAGAUUAAGUGUUUUCAUAA AAAGUACAAAUGUACACAGUUU
209 GTGCTGGGCTTTGGGTTTTTATCCGGCTGATATAAAAATTACGTGGTATCGAGACGGAGAAGATCAAAGTCAAGATAC 55 MR204 Reverse 14289 14366 78 149.0 UUUGGGUUUUUAUCCGGCUGAU AUCGAGACGGAGAAGAUCAAAG
210 TGAGCAGTCTCGACGTGTAATGGAACGATTGTCCGAAAACGATTCTGTGGAGGATGAGATCGTGGAGGCGCGTATTTAGCTATATAAGTAGTCCCGTCGTGTCTTTTTGTAGGATTATTTTTTAACATGTTCTCTACATTTCTTTTAGAGTTTCTGCTTA 304 MR215 Reverse 14983 15142 160 118.2 AUUGUCCGAAAACGAUUCUGUG AUUUUUUAACAUGUUCUCUACA
211 GGAGTTCGCATGGAGTCTGTTTCGGAAACAGCGTGATTGATGTCAATTGGAGTGATGAAACGAGGTTATGTGAATATTC 337 MR236 Reverse 16801 16879 79 115.9 CAGCGUGAUUGAUGUCAAUUGG AUGAAACGAGGUUAUGUGAAUA
212 TATCGTTGTATCTCCTCAAGAACGTCAACGTTATCAGTGTGAAGTTCAACATGTTGGACAGAAAACGTCTGTGACGTCAAAATTGCAATCGTCTGCAGATTCTGGATACGGTGGATCTTTAACTGGTATATTCGTTGTTACCGTCGCTTTAGGGGTCGGTA 330 MR239 Reverse 16942 17102 161 116.2 UCAAGAACGUCAACGUUAUCAG UCUGCAGAUUCUGGAUACGGUG
213 ACGCTATTCAGCCTGGTAAGTCTATGCATTTTGTGCGTTCTTAGTAAAGATGGTTTGGAATACATAGTAATTTATGTTCCAGGGTGACGT 203 MR252 Reverse 17945 18034 90 126.9 UUCAGCCUGGUAAGUCUAUGCA UGGUUUGGAAUACAUAGUAAUU
214 TTCAGTCCATGGCGCGATTGTTGAGATATTTTGAGTATTCGAGTTGTAGCTGAA 307 MR257 Reverse 18323 18376 54 117.9 UUGUUGAGAUAUUUUGAGUAUU UGAGUAUUCGAGUUGUAGCUGA
215 TGGTTATTGAACATTTGGTGAAGTTTGGGATTATATCGAGATGATCGGTACTTACGTTGATGTCTGTTCTTTGAGTGATGTCGTCGATTGTTCGCTGGCCA 334 MR280 Reverse 19731 19831 101 116.0 AAGUUUGGGAUUAUAUCGAGAU ACGUUGAUGUCUGUUCUUUGAG
216 TGGTCATAAATCAATTTTATTGATTAGATGGGGGTACAAGTGTGATTAATAGGGTAGTCAGTGATCA 207 MR285 Reverse 20000 20066 67 126.0 AAAUCAAUUUUAUUGAUUAGAU UGAUUAAUAGGGUAGUCAGUGA
217 CTGAGTGTTGCTCTGAACGCCGTCGTTTTAACATCTTTTGAACGGATGTGAGTTCAGGAAACGTGTTAAGGAAACGTGTTCAGGAAGCGTTTCAG 29 MR287 Reverse 20109 20203 95 162.1 AACGCCGUCGUUUUAACAUCUU AGGAAACGUGUUAAGGAAACGU
218 CTTCTGTCCATAAAAAAAAACGACGGTCAGATTTAGTTATGTGAATGCAATCTAGGATCTGTCTAGTCTGATTTTTTTTTAGATATTAAG 139 MR293 Reverse 20525 20614 90 137.4 AAAAAACGACGGUCAGAUUUAG UGUCUAGUCUGAUUUUUUUUUA
219 CAGAATTGTTATCTTACCATGATAGATGGTTTAAACGTCTGAGGAGGGAGTTTGGTATTATCGCAGTCGTAGCCTAGGATGCACCTTCTG 350 MR295 Reverse 20609 20698 90 115.2 UACCAUGAUAGAUGGUUUAAAC UUGGUAUUAUCGCAGUCGUAGC
220 ATGACGTTCATGGGTTGGAGTCTGTGAATTAAATAAAGACGGATTAGAAAAATGTACCTCTTTAGATAATTTTTTTCATAGATTCTAGAATTCAGAATTGTTAT 34 MR297 Reverse 20687 20790 104 156.5 CUGUGAAUUAAAUAAAGACGGA UACCUCUUUAGAUAAUUUUUUU
221 CGGAATGTCCGAGTGAAATCTACGTCGGTTTGAGTGGACGTGTCTATATGTATATCGATATGTTGTATTCGGATGCTCTG 265 MR303 Reverse 21497 21576 80 120.4 GAGUGAAAUCUACGUCGGUUUG UGUAUAUCGAUAUGUUGUAUUC
222 GGCTGAGTGACATCGTCACACGAAGAGATTTTTTTTAGTGTTATCTGTTATATAGTC 175 MR321 Reverse 22851 22907 57 131.0 CGAAGAGAUUUUUUUUAGUGUU UUUAGUGUUAUCUGUUAUAUAG
223 AGCCGGATATGAAGTCATTGGTCGTTCACAGTTATATGAAAGACTGATTGTGGTTGATGTGCATTGTAATGTCTATGCCTTACTCCCCGGCT 264 MR387 Reverse 27163 27254 92 120.6 AUUGGUCGUUCACAGUUAUAUG GAUGUGCAUUGUAAUGUCUAUG
224 GAGATTTACTGGGGAGAGGCAAGCCGGGAACTGCTCTATCGACTGAACATGAGACGTGTTCGACGAAAACGGGTCTCTGCGCCTTCCACAGTTTTTTC 259 MR427 Reverse 29996 30093 98 121.1 UGAACAUGAGACGUGUUCGACG UCUCUGCGCCUUCCACAGUUUU
225 AGACGAACTACGGATTGAAAAACACAAGCTGCAGATGGATGGTACAGACTAATAAAGTAAATTGGTACTTTGTATCTTTGTGCGTGTTTAAATTCGGGGTGTCT 225 MR429 Reverse 30206 30309 104 124.3 AGAUGGAUGGUACAGACUAAUA UUUGUAUCUUUGUGCGUGUUUA
226 TGACTGTTCAAGTATCTGATCTTTCCAGCTCGATGGCCGAACAGAATGATTCTGATGTTGAGCAGTCG 266 MR435 Reverse 30607 30674 68 120.3 UUCAAGUAUCUGAUCUUUCCAG AGAAUGAUUCUGAUGUUGAGCA
227 TTCGGAGTTCCGAGATCCAATTCTGAATAACGTTAGCATCTGGGAGTAGATAATCTTGTTCTAGTGAGTCGGCTGCGAAAGACATTTGATCTGGGACACGTCTGGCTCTCTTAGCTGGCTTAGCTTCAGCGGTGATGTTTCTGGGTGTTTCGAA 162 MR441 Reverse 30942 31095 154 133.2 UCCAAUUCUGAAUAACGUUAGC UUUGAUCUGGGACACGUCUGGC
228 GATTCGGATCGAATTCGTGATACCAAGAGCCTTTGAACTGCGATACATAGTGGACAACTCTCTTTCGACGACCTGATAGCATTCTTTTGGAGGTCCAAGAGAGTTGTTTCACGGTGAATAAAACGGTGTTGTTCTGCCGGGTGATAGTGGCTTGTCCGAACGGGGATGCGTTTTCGTCTAGCAAAGTGGGTTGTCCTGAAGTATTGGGAGTCTCTTGTCGATTCGATTC 100 MR449 Reverse 31560 31783 224 141.9 CGACGACCUGAUAGCAUUCUUU GGGAGUCUCUUGUCGAUUCGAU
229 GGACAACTCTCTTTCGACGACCTGATAGCATTCTTTTGGAGGTCCAAGAGAGTTGTTTCACGGTGAATAAAACGGTGTTGTTC 106 MR451 Reverse 31655 31737 83 140.6 CGACGACCUGAUAGCAUUCUUU AAGAGAGUUGUUUCACGGUGAA
230 CATAGTGGACAACTCTCTTTCGACGACCTGATAGCATTCTTTTGGAGGTCCAAGAGAGTTGTTTCACGGTG 321 MR452 Reverse 31673 31743 71 116.9 UGGACAACUCUCUUUCGACGAC UCCAAGAGAGUUGUUUCACGGU
231 GTTAACGGCCATATAGTGATTTTCAGTTCACCGTTTTTCCATAACCGTAAACCTGTGTAGAAAGAATCGTTGTTTGGTACGTTAGC 312 MR455 Reverse 32196 32281 86 117.7 AUAGUGAUUUUCAGUUCACCGU ACCUGUGUAGAAAGAAUCGUUG
232 TTGACGGAAGATTTCCACCTGTACGAGACCGCTTTTCCTCTACCGCTCGATAGGTCGAAGTTTTCATTTCAA 276 MR467 Reverse 33056 33127 72 119.7 AGAUUUCCACCUGUACGAGACC CGAUAGGUCGAAGUUUUCAUUU
233 AGCGTAGAGGATGGGGTTGATGAGACAATGAAAGTTGGGAACTAACTTTGCCATGGTAGCGATGACTTTCCTGTGGCT 114 MR492 Reverse 34931 35008 78 139.2 AAAGUUGGGAACUAACUUUGCC UGCCAUGGUAGCGAUGACUUUC
234 AGAGGCGAAGCCGATGGTCTGCGGGTTGGATTGCTAGCTCTGGCGGCCGAGTTTTGTCTAGAACGCAAAAAAGCTCGGCGGTCAAACAGTTCCCCTCGAACGCATTGTTTTAACCTCT 258 MR494 Reverse 35031 35148 118 121.1 AAGCCGAUGGUCUGCGGGUUGG AGCUCGGCGGUCAAACAGUUCC
235 GGAACTTAGTAATGCTGCCGCCTGGCTGGAGAAGTTTGGAACAGTTTCGGTGTCGCGTGGTGATGCGTTCTCAGTTCC 339 MR498 Reverse 35177 35254 78 115.8 UAAUGCUGCCGCCUGGCUGGAG UUUCGGUGUCGCGUGGUGAUGC
236 TATCGTACCGTGGGTTGATCTGGTGCCTGAAGTTTTTCTATGGTTAGATATGAAACATAGGACATCGGTGTTTCAATTATAACGGTTGATG 231 MR500 Reverse 35409 35499 91 123.8 UGGUGCCUGAAGUUUUUCUAUG AUGAAACAUAGGACAUCGGUGU
237 GAAAACGATGATTGTGAATCCTCTTCGGTGTTAGAGAAGTCTCTAGTTGTGATGGTGATGTTCATCGTCGTTTATC 251 MR501 Reverse 35496 35571 76 121.6 GAUGAUUGUGAAUCCUCUUCGG UUGUGAUGGUGAUGUUCAUCGU
238 GATTGAGGTCTGTAGGTTTTCCGTGGTCACTTGTTTACACGGGTCGGTTTTGTCCATGTAGAATAAAGTTTTATACGCGTCATTGTGATATGCCGACTCGAAAGCCGTGTCTATACTTATCCCTGAGTC 238 MR509 Reverse 36176 36304 129 122.6 AUGUAGAAUAAAGUUUUAUACG UGAUAUGCCGACUCGAAAGCCG
239 GAGACGTCGTCGAGAATGATAGCTGCTGTTCGCGGTCTTTGCTCCATGATCAGAGATCGCATCGGTGCGTGCACACGACGTGTGACGTCTC 296 MR521 Reverse 37044 37134 91 118.7 UAGCUGCUGUUCGCGGUCUUUG AGAUCGCAUCGGUGCGUGCACA
240 CGCGACGTCGCGTTATTTCTGGGCACAAGAATTAATGGCGTTGGCAGAATCTTCGGTATTGGTAAAATGTGTTAGAGATCATGTGGCGGCGCG 13 MR537 Reverse 38546 38638 93 172.8 CUGGGCACAAGAAUUAAUGGCG UGUUAGAGAUCAUGUGGCGGCG
241 TTCTCGTGTGGTGGAGGATGTGGGGTGTCGGATGTATAAGGTTACAGGGCATTCGGTAATCGACACTCACTTCGCAATTTATAGTACAGAGGG 57 MR544 Reverse 39158 39250 93 148.6 CAGGGCAUUCGGUAAUCGACAC AAUCGACACUCACUUCGCAAUU
242 CCGAACTAAGCAGTGGAGGTACCGTTTCATCGTTCTCCTGGGAGAGACTGGCAGTGTCTATTGCTATGACTACGACGAAGACGGTGTGTTTCTCGTGGCTCGAGATGTGGAAATGTTGGTCTCTGAGGGTCTTCGAAACGTCGATGGATTCTACGGTTTTTCGG 287 MR548 Reverse 39327 39490 164 119.3 UCUAUUGCUAUGACUACGACGA UCGAUGGAUUCUACGGUUUUUC
243 ATGCCCAGATTAGAAGGTTGATGAAATCACAGACTGTTTTGTTGCACGATTCGGGTTTGCAGATTTCGATCTGTGATCTGACGTAT 213 MR581 Reverse 41839 41924 86 125.3 AAGGUUGAUGAAAUCACAGACU UCGGGUUUGCAGAUUUCGAUCU
244 GAGACGTTAACTAACAATTGGATGTATTTGATATTAATGGCTGTGGTTTCTTTTCTGATTTTTGGTGAGACTTTGTATCGACCGTCTACGGTGTGAGAAAAGTTTTCCGTATGTTGTGTATTAAACGTTTCTTATTATTATAACGTCTT 130 MR593 Reverse 42493 42641 149 137.9 AAUUGGAUGUAUUUGAUAUUAA CUACGGUGUGAGAAAAGUUUUC
245 GCTTTTTTCATGCTTTATAAAAATCTACTTTGAATACTTGACTCGAGTGTCCAGTGTCTTGTTCAAGACGGTGTGTGATCTCTCTGTTTGTAAAAGGTTGGATGGGTGGGGATGAGTGGC 331 MR615 Reverse 43883 44002 120 116.2 CUUUAUAAAAAUCUACUUUGAA GGUGUGUGAUCUCUCUGUUUGU
246 GGGCGCTCTGATTTTAAAGCCATGGAACCTGAAGAAGCTAGCTGTGATCTTATCAGGCTGACTTTTCAGTTATCGGTGGAGAATGGAGCTCCC 164 MR634 Reverse 45267 45359 93 132.7 UGUGAUCUUAUCAGGCUGACUU CUGACUUUUCAGUUAUCGGUGG
247 CACGTGGATTTCGATTTTGGTGTCGTGACCGATTTAGTGAAGTGGTTGGCGCCTCATACCAGGGTCAAAAGGAATGTG 133 MR650 Reverse 46239 46316 78 137.7 AUUUUGGUGUCGUGACCGAUUU UUGGCGCCUCAUACCAGGGUCA
248 CGGTGTTACACGATGTACCTGCGGACGAGTTTCTTCGCATTCCCAAGTTGGAAAAGTATTGTTTGCGGATGCCGATCGTTAATCGTGTGATGCTG 206 MR666 Reverse 47252 47346 95 126.5 AUGUACCUGCGGACGAGUUUCU UGGAAAAGUAUUGUUUGCGGAU
249 GGGGTAGTATTCTGTCATCACGTGGTTCGGTACTCCATCATGGATTATAATGTGCCTATTCC 183 MR678 Reverse 48021 48082 62 130.2 UGGUUCGGUACUCCAUCAUGGA AUGGAUUAUAAUGUGCCUAUUC
250 GTATCGAAGAGCTTTTCACGTGGAAGGAGAATTAGATTTGTTCGAGAAGCTGCTCAGATGGTTTCAAGATGGAGTCGTTTCTCTTTCCGTGCTGGCTTCTTCAGATGC 91 MR683 Reverse 48606 48713 108 143.4 AAGGAGAAUUAGAUUUGUUCGA UUUCAAGAUGGAGUCGUUUCUC
251 GTAGAGATCGGGTCTTTCAAGGAATTTGTCTAACGTGGTGTGGGATATGCTTCATCGAGATAGTTGGGCCAGAAGTCGAGGGGAGGATTTTGCTTTAT 333 MR695 Reverse 49414 49511 98 116.1 UUCAAGGAAUUUGUCUAACGUG CAUCGAGAUAGUUGGGCCAGAA
252 GATTTGCATCAAGCGGGGAGCTCCGACCGTTTTGAATTGCGCGTACGGAATGTTCAATGTTTGTGTAAATT 288 MR726 Reverse 52076 52146 71 119.2 CAUCAAGCGGGGAGCUCCGACC ACGGAAUGUUCAAUGUUUGUGU
253 GGCTTCCGTGATGCAGTTGGAAAGACCGTGTTCGAATATGTTATTGTTACCGAGGACTGAGCATGTTTTTATTATTCGACTGAGGGAGGAAGTC 303 MR736 Reverse 52836 52929 94 118.3 UUGGAAAGACCGUGUUCGAAUA ACUGAGCAUGUUUUUAUUAUUC
254 GCTGGTGAACACGTTCTGTTAAGAAGCTCTCGTCGAATGGTAAACCCGAAGTTTGTGAGTACAGGGTCCATCCTGAGGTCGGTGGGGCTTTTAGTGTATGAAGCGTCAACTCTTTCTCTATTTGTTCTACTAAATGTTCGTATCGAGTTAAGGACGGAAGGGCTTCGGTACAGTTGTATGTTTGGTGGGTGGTTTTACGAGGATTCTTTTTACTGGT 32 MR758 Reverse 54100 54316 217 157.0 CGUCGAAUGGUAAACCCGAAGU UCUACUAAAUGUUCGUAUCGAG
255 GATTTTGTGACGTGATCGACTTTGGACATCTCAGATAGATTTTTATTCAAGATCTGTGGGGAAAGTTGATCTAGTCTATTGATGTC 325 MR770 Reverse 54859 54944 86 116.5 AGAUAGAUUUUUAUUCAAGAUC UCUGUGGGGAAAGUUGAUCUAG
256 GGTCTCTGGTAAGATTGTTCGGCGGTAATTGATTAATTAGCTCTTTCAGTAGTTCGAAGGTGGCAGGTGGCCAGAATTCTTGGGTGACTAGTTTATCGACTACGGTATTAAGGATTTCAGCTAGATGACT 112 MR787 Reverse 55615 55744 130 139.5 AUUGAUUAAUUAGCUCUUUCAG AGAAUUCUUGGGUGACUAGUUU
257 TCGCTGTTTAGCGTGTGCCGTTGTGGCTAGACTTCCTTGTCAGCGTCGATATGTCTAGCGGGTCTGGTTCAAACAGCGGTGCCGGTAAAAAAGACGA 169 MR844 Reverse 59771 59867 97 131.8 UGCCGUUGUGGCUAGACUUCCU GCGGGUCUGGUUCAAACAGCGG
258 ACGGTGTCAAGCGGCAGTCGAGCCGAAGGATACGTGTTTAGACGACGAGACTTGCGAGAATCGCTGTTTAGCGTGTGCCGTTGTGGCTAGACTTCCTTGTCAGCGT 108 MR845 Reverse 59822 59927 106 140.1 AAGGAUACGUGUUUAGACGACG AAUCGCUGUUUAGCGUGUGCCG
259 GTCGTAATGGGAGCAGCTCATTAGTTCGCATAGGAGGCAGACGGTGTTAGTTTGATTTTTCCATTGTAAGACGGGAATTGGGGAGAGGTAGATGGGGCCTGTGGTCTTCTCGTATTCTGGCTCATCCGCGTCATTCAAAGAGTCGAGCTGCTGATGTTTGGCTTCGGTTAGACTGGAGAGTGGCGTGTTAGGCATGAC 104 MR895 Reverse 63242 63439 198 140.9 AGACGGUGUUAGUUUGAUUUUU GGUUAGACUGGAGAGUGGCGUG
260 CATGTCCTCTGACGATGTCGAGTGTGATGCTGTAGTCTCCTTTGGTGGCGGAGAGGATTTGAGAAATGCATTCGCAGGGGATGTG 340 MR920 Reverse 64569 64653 85 115.7 UCUCCUUUGGUGGCGGAGAGGA AGGAUUUGAGAAAUGCAUUCGC
261 GGTCCGTAAAACCTCGTGTGAATTTGTGAAAAAGGTGATCAAAGATGTTTTGGCCTTGTTGTTTGACGATCCCGAGGTTTCGCAAGCT 202 MR931 Reverse 65345 65432 88 127.2 AAAGGUGAUCAAAGAUGUUUUG UUGUUGUUUGACGAUCCCGAGG
262 TCATGACAACTTTGCATCACCGGATTTTTTAAAAACTTTCTTTAATGAAGAAGATTATGTGGAGGGTGGGGTTGAGGCTAAAGTCATTTATGG 125 MR937 Reverse 65652 65744 93 138.2 ACUUUCUUUAAUGAAGAAGAUU GAAGAUUAUGUGGAGGGUGGGG
263 TTATGGATAACGGTGAATGTCCAGAAGCGGATAAGATTTACGAAGTCAAGTTTGAGAATGGTACAGTTTACCGGTTTGTGA 313 MR942 Reverse 66007 66087 81 117.6 UAAGAUUUACGAAGUCAAGUUU AAGUUUGAGAAUGGUACAGUUU
264 AATAGGAAGTTGTGCGCCTATCGATAATGTCGATGTTTACGAATTCCCTTCTGAATACGAATTGTTGTTGGGTTTCTTCATGTT 277 MR955 Reverse 66807 66890 84 119.7 UAUCGAUAAUGUCGAUGUUUAC AUACGAAUUGUUGUUGGGUUUC
265 AATCTATGGATACGGTACGAGTTTTGTTCCCAATCTTCACCGTGTATCTATCAGCAATTGGATGATGGCTAGGAAGATTGGACAATACATGCTGGATCATGGATT 48 MR959 Reverse 67245 67349 105 150.0 UUCCCAAUCUUCACCGUGUAUC AUGAUGGCUAGGAAGAUUGGAC
266 CGTCTGTGAAGATCTATCTTACGATGAGCATCTGTATGTGGTCAATAATTTGATTCACAAAAAGTTGCCTGTGGAGTCTTTACCTACG 348 MR1007 Reverse 71142 71229 88 115.3 UAUGUGGUCAAUAAUUUGAUUC ACAAAAAGUUGCCUGUGGAGUC
267 GTGTGCGCAGTGCTACGAGGAGCTGACGGTGGTCCCCAACCAGGGCCGATCGTTGAACAAGCGTCTGCAGGGCTTGCTGTGCAACCAT 311 MR1017 Reverse 72156 72243 88 117.7 GUGGUCCCCAACCAGGGCCGAU CGAUCGUUGAACAAGCGUCUGC
268 GTGACGTGCTCTGTATTAACGTTCGTCATCAGTAAAGCTTTTTTTAAGAACAAGGGTCTGCGTGTGGTCTGTTAGTGAGGTATTTGCGAGTCAT 170 MR1026 Reverse 72866 72959 94 131.7 AACGUUCGUCAUCAGUAAAGCU AGGGUCUGCGUGUGGUCUGUUA
269 TACGGTGGTTTCAGACCGGGGTGTGGTTGATTTTTCTCTGGAAAGTCTGGAGAAAGTTTTCTCGACTGGTGTGGAATCTGTGTCCG 240 MR1030 Reverse 73108 73191 84 122.2 CGGGGUGUGGUUGAUUUUUCUC GAAAGUUUUCUCGACUGGUGUG
270 GATTTGAAGTGTGAGAATGGTGTGCCGGCTCCCCGAGCCGCTACGGTGGCTCGAGAGTCTCTAATGCGAACTATTTTTGAACAGAGGTC 226 MR1037 Reverse 73605 73693 89 124.3 GAGCCGCUACGGUGGCUCGAGA CUCGAGAGUCUCUAAUGCGAAC
271 GGTGCTACTCCAGATTTCGAGTCGGTGGTACAGTATATGGCTCGAATCAAGGATTTGAAGTGTGAGAATGGTGTGCC 295 MR1038 Reverse 73668 73744 77 118.7 UCCAGAUUUCGAGUCGGUGGUA AAUCAAGGAUUUGAAGUGUGAG
272 GATCGTGGATTGTATGTCCCTTCGGTCAGCGAAGTCTTGTTCTATTACTTGTACACATCCTGGGGGCAAGCGCTGCGTTTTTCAGAAACGACGATTCTGATC 115 MR1060 Reverse 75701 75802 102 139.2 UCGGUCAGCGAAGUCUUGUUCU UGGGGGCAAGCGCUGCGUUUUU
273 GATTTTTCCGCTTCGGTACGTACTCCGGTGATTCGGTACGACGGTGGTGTTTTGACGAAAGTGACTTCCTTCTGTCCTTTTGCGATCTATTTCCACAATACCGAAGGTATCAGGAGTTTCTGTGAAGATCATGGGAACGTC 283 MR1065 Reverse 76133 76273 141 119.4 UACUCCGGUGAUUCGGUACGAC CCGAAGGUAUCAGGAGUUUCUG
274 GTTGATGATAGCGTTACGGGGAACGTATATAAGAACTGCGGAATGGTGACAGATATCGAGCATTCCGTAATTCTTGTATGCAAACCCCGACACGTGAAACGGCATTAAT 187 MR1077 Reverse 76811 76919 109 129.8 GUAUAUAAGAACUGCGGAAUGG AGCAUUCCGUAAUUCUUGUAUG
275 ACCTAGCTAGATCGTGTTTCAATGTAAAGTTGGGCTTTTTATTCAGTTGGCAATCGATGACGTACGTCAACATATAGATTCTATACATTGAAATATAGATTAAGCGGT 99 MR1080 Reverse 77068 77175 108 142.0 AGAUCGUGUUUCAAUGUAAAGU AUAUAGAUUCUAUACAUUGAAA
276 GAAGAGACTAATGTATATGTTGTGTTACGTATTTGTTACGAAAGCAACGACAATAGATACGTCATGTTATGATTCTCGTCTTTCGACCTAGCTAGATCGTGTTTCAATGTAAAGTTGGGCTTTTT 146 MR1082 Reverse 77136 77260 125 135.3 UUGUUACGAAAGCAACGACAAU UCGUCUUUCGACCUAGCUAGAU
277 GAATGCAATATAAAGAGTATGTATATGGGGGCTTAATGTATAGATTCTATACATTAACACCGTAGAGGCGTGGTCTGTTTGCGTC 342 MR1089 Reverse 77419 77503 85 115.5 AUGUAUAGAUUCUAUACAUUAA CAUUAACACCGUAGAGGCGUGG
278 TCTCCAGGTATTCGTGCCGCGCGGACGTGCGCACAAGACGCATCATCTTTACACATCGACTTGAGCACACGTCCGATCCGATGAAATGTCTGGCTTGA 343 MR1104 Reverse 78475 78572 98 115.5 CGCGGACGUGCGCACAAGACGC ACACGUCCGAUCCGAUGAAAUG
279 GCGGCTGATCTCTTAGAAGGCAAGCGGAGATCTCTTGAACGGCCAGAGCGTCTCGTCGCTGCTCTTGCTGGAGAGCCGC 209 MR1367 Reverse 114953 115031 79 125.9 UUAGAAGGCAAGCGGAGAUCUC AGAGCGUCUCGUCGCUGCUCUU
280 TTCCTTGTACCTGTTCTTTGTGTTTTGTTTTATATCAGTCTGAGACTTTTTCGCTTACTCTTAGGAGTAGGAGGACGTAGAAGCGTTTTCTTATCTTTAGTGCGTGGAGGTTTTAATTGAACTACTGCAGTGATAGGCTTTTTGGGAG 111 MR1398 Reverse 118682 118829 148 139.5 UAUAUCAGUCUGAGACUUUUUC UUUAAUUGAACUACUGCAGUGA
281 ACTCTGATCTGATCATGCAATCTCTTAAAGTACGCTTGGACCTCCGCATGTGACAAAAACAATCTGGTCATATCCGACGCATATGAGGGATTGCGAATCAGATTCGGCGGT 124 MR1457 Reverse 125888 125998 111 138.3 CAAUCUCUUAAAGUACGCUUGG UAUCCGACGCAUAUGAGGGAUU
282 TGGCAAATCCTTCAGAAAGATGCATTATTGCTTTGACGCAGAAGCGATTCTGATTATTCTAGATTCTTTTGTTA 250 MR1493 Reverse 129010 129083 74 121.6 UUCAGAAAGAUGCAUUAUUGCU CGAUUCUGAUUAUUCUAGAUUC
283 GCACATAAAATAAGGTGGTCCCTATGACTCAATGTTCTTGGCACATGCTGATTGACGTCAATGGAGTACTGCCAAGAACATTGAGTCATAAAGACCACCCATTCCTGGC 3 MR1598 Reverse 141943 142051 109 185.7 UCCCUAUGACUCAAUGUUCUUG AGUACUGCCAAGAACAUUGAGU
284 AGGGATCAATGTATCAGCTATACCTTGGCCATAGGCCAGCAGGGATCAATATATCAGCTATATCTTGGCTCTAAGTCAGTAGGGATCAATATATCAGCTATATCTTGGCTCTAAGCCAGTAGGGATCAATATATCAACTATATCTTGGCCCTAGGCCAGCAGGGATCAATATATCAGCTATATTTTGGCTCTAAGCCAGTAGGGATCAATATATCAGCTATATCTTGGCCCTAGGTCAGCAGGGATCAATGTATCAGCTATACCTTGGCTCT 37 MR1603 Reverse 142505 142776 272 154.3 AUAUAUCAGCUAUAUCUUGGCU AAUGUAUCAGCUAUACCUUGGC
285 GGCCAGCAGGGATCAATATATCAGCTATATTTTGGCTCTAAGCCAGTAGGGATCAATATATCAGCTATATCTTGGCCCTAGGTC 109 MR1604 Reverse 142540 142623 84 140.0 AUAUAUCAGCUAUAUUUUGGCU AUCAAUAUAUCAGCUAUAUCUU
286 GGCCAGCAGGGATCAATATATCAGCTATATCTTGGCTCTAAGTCAGTAGGGATCAATATATCAGCTATATCTTGGCTCTAAGCC 161 MR1605 Reverse 142660 142743 84 133.3 AUAUAUCAGCUAUAUCUUGGCU AUCAAUAUAUCAGCUAUAUCUU
287 CGGTTCAAGATGGACAAATTGTATATTTCATATTCAAACAGTTGTCCTGATGAAAAGTGAGAATAATATACAGTTTCAATTTAAAATTGAACTG 190 MR1620 Reverse 144010 144103 94 129.3 ACAAAUUGUAUAUUUCAUAUUC AAAAGUGAGAAUAAUAUACAGU
288 GTAAATCTAGAACATGCTCGCCAAACATAAAGTCTCGAGATTATACATGGCCTTTTCTCTGGACTGTGTTTGCTTCCATCTGTGAATGGATTTGC 212 MR1645 Reverse 147930 148024 95 125.3 ACAUAAAGUCUCGAGAUUAUAC UGGACUGUGUUUGCUUCCAUCU
289 GTGGTCCGGCGAGAGCGGGGCTAGGTACACGTGCTCTGTTTCTCACACGCTAACATCTGCAACAAGCAGGCCACGTGCACTCCGCCCCGCATTTCGCCGCACTAC 138 MR1700 Reverse 154840 154944 105 137.4 AGCGGGGCUAGGUACACGUGCU AGCAGGCCACGUGCACUCCGCC
290 GGCATGTCAACGCGGACTGAGTACCTTGTCTCTACACTGTGTCTCCAAACTAATAGACACGTGTACTTGACAGGGCACTCTGTCCTCTCGTCTGCACTCC 27 MR1701 Reverse 154945 155044 100 163.0 GUACCUUGUCUCUACACUGUGU CACGUGUACUUGACAGGGCACU
291 GACAGCTTAGCTCCATCATCCCTGATCGTCGCATCTTCTCATAACATCTACATCGACATTTAGATGGAAACGTCCCTTGCCATATTCTCACCTACATGTCGATTAAGATTTCATGAGAACGATCGCTGGCATGTCA 129 MR1702 Reverse 155036 155149 114 138.0 UACAUCGACAUUUAGAUGGAAA UCAUGAGAACGAUCGCUGGCAU
292 GCTCCCCACGCTTTCTCTACCCTCACGTGGGACCGCCACGAGCCACAGCGCCGCGCGTTCTCACGGGGCTGTAGGGACCGCGCGTCGAGC 268 MR1703 Reverse 155186 155275 90 120.3 ACCCUCACGUGGGACCGCCACG CGCGUUCUCACGGGGCUGUAGG
293 GCTGTCCGGGCGGCTGTCGACGGCGCCTCGGGCTCGCCTCGGCCTCCGGCGGCGTCTCGCGGCCGTCTCGAGAGC 24 MR1727 Reverse 157241 157315 75 164.9 UCGGGCUCGCCUCGGCCUCCGG CGGCGGCGUCUCGCGGCCGUCU
294 GACGCCCCCGAGGCCCCTGAGGCCGGCGAGCCGGGGGCCGCGTCGCCCATGCTCCCCGGGCGGCTGTCCGGGCGGCTGTCCGGGCGGCTGTCGACGGCGCCTCGGGCTCGCCTCGGCCTCCGGCGGCGTCTCGCGGCCGTC 4 MR1728 Reverse 157249 157389 141 183.6 CCCGAGGCCCCUGAGGCCGGCG UGUCCGGGCGGCUGUCGACGGC
295 GCCGCTTTCGGGCCCGGGGGTGTCGGCGCGAGGCGGCGCCGGCGGCGCTGGCGGCGCTGACGCCCCCGAGGCCCCTGAGGCCGGC 79 MR1729 Reverse 157363 157447 85 145.4 CUUUCGGGCCCGGGGGUGUCGG UGGCGGCGCUGACGCCCCCGAG
296 GCGGCGTTGAGGCCGGGCGCGGCGGCGTCGCTGGGCTTGAGGCCCAGCCAGGAGCACCAGGCGGCGGCGTTGGCGGCGGTGGCGGGGGCCGC 120 MR1731 Reverse 157493 157584 92 138.9 GGGCGCGGCGGCGUCGCUGGGC AGCACCAGGCGGCGGCGUUGGC
297 CGAGGCCCCGCCGCCGGCACGCGCCCTCGCGAGAGTCTTCCCGCTCTGTCCGGTCACAGGCACCTAGGGCACACGGAGGTGGTGGACGTCTTAGGGCAAGGGCGGCGCGGAAGGCCCG 299 MR1747 Reverse 158680 158797 118 118.5 CGAGAGUCUUCCCGCUCUGUCC ACACGGAGGUGGUGGACGUCUU
298 GGTACAGGCCGTCCGTGCGGCACCAGCCGTCCGACGTCCACGGCGAGCGCGCCTCCAGCCGGGCGGCGTGGGCGCGGTCCTGAGCCGCCGACGGCACGGCGTGCACC 68 MR1755 Reverse 159283 159389 107 146.8 CGUCCGACGUCCACGGCGAGCG CGGCGUGGGCGCGGUCCUGAGC
299 GGCGTCGCGGGCCGCCAGGTGCAGGGTCAGTCGCGCCAGGTCCAGCAGGAACACGCGGAACCGCGGACCCACGCCCAGGTACAGGCCGTCCGTGCGGCACC 346 MR1757 Reverse 159366 159466 101 115.3 AGGGUCAGUCGCGCCAGGUCCA AACCGCGGACCCACGCCCAGGU
300 CGCGGCTGGCGGCCGCCAGCGCCTCGCTCAGCCGCGCCGGCTCCGTCGTGCTGCGGGGCAGCAGGTCGCACGCGTACAGCCGCG 92 MR1758 Reverse 159501 159584 84 143.3 CGCCGGCUCCGUCGUGCUGCGG UGCUGCGGGGCAGCAGGUCGCA
301 GCGTGCGCCTCCGCCACCGCGTGCGCCGCGTGCGCCGCGCGGCTGGCGGCCGCCAGCGCCTCGCTCAGCCGCGCCGGCTCCGTCGTGCTGCGGGGCAGCAGGTCGCACGC 18 MR1759 Reverse 159512 159621 110 169.1 GCCGCGUGCGCCGCGCGGCUGG CUCAGCCGCGCCGGCUCCGUCG
302 GCGTGCCGGCGCGCAGCAGGTGCCCCAGGTCGTCGGCCAGCGGGTACAGCTGCCCGTCCAGCGTGC 286 MR1764 Reverse 159891 159956 66 119.3 CCGGCGCGCAGCAGGUGCCCCA GGGUACAGCUGCCCGUCCAGCG
303 GCAGCTGCTGGTGCGCGCGCGGGTGCAGGAACAGCGCGTCGGCGCGCGGCGTCTCCCAGAACTCGCGGTCCACCGGCGGCAGC 284 MR1766 Reverse 160018 160100 83 119.4 CAGCGCGUCGGCGCGCGGCGUC AGAACUCGCGGUCCACCGGCGG
304 GCGGTCGTGGCGCAGCGCGTGCGACAGCGCCGCCGCCGGGCTGCGGGGCGGCGAGCGCTGGCACAGCCCCGGCAGGCCCAGGAGCTCGGCGTCGCGGGCCCGCAGCCCGGCGTCGCGCTCGCCGCTGCGCCCGCCGC 73 MR1769 Reverse 160179 160315 137 146.2 CAGCGCCGCCGCCGGGCUGCGG UCGCGCUCGCCGCUGCGCCCGC
305 GCTCGCGCGAGTCGCGCGCGCGGAACTTGCTCAGCCGCCGGGCGGCCACGTCCTCGGGCCGCGACGCGCCGCGCGGGTACTCCTGCGGGT 94 MR1771 Reverse 160371 160460 90 142.9 GGGCGGCCACGUCCUCGGGCCG UCGGGCCGCGACGCGCCGCGCG
306 GGCTCTCCGCGGCCGCCGCCGCAGACGACGTTGACGGCGCCGCGGCGATGGGGGGCTCCGGCGTCGTCTCCAGCGGCGGCCGCGGCAGCGGCC 14 MR1774 Reverse 160467 160559 93 171.8 GACGACGUUGACGGCGCCGCGG CGGCGUCGUCUCCAGCGGCGGC
307 GGACCTCGCCGCCGGCGCCCTCTCCGCGGCTGGCCGCGGCGTCGTCGGCGTCGTCCCCGGCTTCGGCCCCCGAGCCGGCCGGGCTCTCCGCGGCCGCCGCCGCAGACGACGTTGACGGCGCCGCGGCGATGGGGGGCTCCGGCGTCGTCTCC 21 MR1775 Reverse 160489 160640 152 168.8 CUGGCCGCGGCGUCGUCGGCGU AUGGGGGGCUCCGGCGUCGUCU
308 GGGCCCGGCCAGGGCCGCGCCGCAGGGGCCGCCGCCGGCCGGCTGCTGGCTGTCCTGGGCGCCGTGGCCGCCGCCGCCGCCGCCCTGGCCGCCTTGGCCGCCGGCGTGGCCGCGGACCTCGCCGCCGGCGCCCTCTCCGCGGCTGGCCGCGGCGTCGTCGGCGTCGTCCCCGGCTTCGGCCC 188 MR1776 Reverse 160572 160753 182 129.7 GCCGCCGCCGGCCGGCUGCUGG CGGCGCCCUCUCCGCGGCUGGC
309 GGGGCCGCCGCCGGCCGGCTGCTGGCTGTCCTGGGCGCCGTGGCCGCCGCCGCCGCCGCCCTGGCCGCCTTGGCCGCCGGCGTGGCCGCGGACCTC 90 MR1778 Reverse 160634 160729 96 143.6 UGCUGGCUGUCCUGGGCGCCGU CGCCGCCCUGGCCGCCUUGGCC
310 GCGGCGGGCGGCCCGCGGGCCGGGTGGCAGCTGCAGTCGCAGCAGCAGGGCCCGGCCAGGGCCGCGCCGC 309 MR1780 Reverse 160731 160800 70 117.8 GGCGGCCCGCGGGCCGGGUGGC AGGGCCCGGCCAGGGCCGCGCC
311 GCTGCTGCCGCCGCTGCTGCTGCGGCTGCTGCTGCCGCGGCCGCTGCTGCGGCGACCACGCCATCGTCATCGCCTCAGAAGCGGTAGGGCGGCTGACGGCGCCGGAGCGGCGCGGCGACTGGCAGCAGC 54 MR1789 Reverse 161516 161644 129 149.0 CUGCCGCCGCUGCUGCUGCGGC AUCGCCUCAGAAGCGGUAGGGC
312 GGCCGCGGCTGCTGCTCCTTCGGCCGCGGCTGCTGCTGCCGCCGCTGCTGCTGCGGCTGCTGCTGCCGCGGCCGCTGCTGCGGCGACCACGCC 105 MR1790 Reverse 161583 161675 93 140.8 CUGCUGCUCCUUCGGCCGCGGC UGCGGCUGCUGCUGCCGCGGCC
313 ATGTGTTTCGGTTGTGAACAGTGGTATAAGTGTCAGTTATCTACAAAAGTATCGTGGTGGCCTTTTGATTACAACGTGAAGGACGT 246 MR1802 Reverse 162315 162400 86 121.7 UAAGUGUCAGUUAUCUACAAAA UGGUGGCCUUUUGAUUACAACG
314 TGGCTCGTTTTTGGTTTAGAGGGGTGTCTGATGTTTTTGTGACGAGTGCCTATATTCAGATGGGAGGTGGTAGAAATGTCAGGGATTTACGTAAACGGCTGAGGAAACA 324 MR1807 Reverse 162495 162603 109 116.7 AGAGGGGUGUCUGAUGUUUUUG GAGGUGGUAGAAAUGUCAGGGA
315 TGAACGCCAAGCGGTGATTCAGATGAAAATGACTTCCAGGGACATTACCATTTGGGTGACTTTGGCGCTCA 42 MR1812 Reverse 162871 162941 71 153.0 CCAAGCGGUGAUUCAGAUGAAA UUACCAUUUGGGUGACUUUGGC
316 CCATTTACCGAGTGACTGGTATACTGTCTGCCAATGTGTGCTGATGATGGTTTGGAATGCGTTCGTTTATCAAGAAGTGTGTTGGTTATTATGTATAATGG 143 MR1821 Reverse 163430 163530 101 136.1 UGGUAUACUGUCUGCCAAUGUG UGCGUUCGUUUAUCAAGAAGUG
317 GTATTGTAGATTTCGGCGTCATATGTGCTCAGAACCATTTACCGAGTGACTGGTATACTGTCTGCCAATGTGTGCTGATGATGGTTTGGAATGC 224 MR1822 Reverse 163471 163564 94 124.3 ACCAUUUACCGAGUGACUGGUA GUGUGCUGAUGAUGGUUUGGAA
318 AAATGGATCAAGACACTATGTGGCGATGGACTATAGGAATAAGTATTGTAGATTTCGGCGTCATATGTGCTCAGAACCATTT 74 MR1823 Reverse 163525 163606 82 145.9 CUAUGUGGCGAUGGACUAUAGG GUAGAUUUCGGCGUCAUAUGUG
319 CCATGGTGGACTCAGAAGATAGACCATGAAATCGGACTCAGTTTGATTCTCGAGGTATCTTCCCTTACCGTCTGG 267 MR1826 Reverse 163812 163886 75 120.3 AAAUCGGACUCAGUUUGAUUCU UUGAUUCUCGAGGUAUCUUCCC
320 AGCAAATCTGTTTATGTTCTATGTCGATACATATGTTTGCGTTTCGTGCATAATGAAAACTATCTGTCAGTCTGGATGCTTATTCGGTTTTTGCT 273 MR1833 Reverse 164281 164375 95 119.9 UAUGUCGAUACAUAUGUUUGCG UGAAAACUAUCUGUCAGUCUGG
321 TATGTCGTTGTGTCTCCTTATGACATATATGGGTGGTATGGTGGAGCATTACGACGTG 291 MR1861 Reverse 167514 167571 58 119.1 UGUCGUUGUGUCUCCUUAUGAC GUAUGGUGGAGCAUUACGACGU
322 AAGTAGCGCAGAATTTGGAAGATCTGGCTGAAAACGGTCTGATGTGGTGCGATTCGGTGTACAAACATCCGAGTACTCCGTACAGCACCGTGGAGCCCAGATACCACGTCGATCGTCTACTT 338 MR1906 Reverse 171378 171499 122 115.9 UUCGGUGUACAAACAUCCGAGU UCCGAGUACUCCGUACAGCACC
323 GGTACATCCTGGGGGCGGTGGGAACTCCACGAGCGGGTCGACCTTTTCACGTTGACCTGCTTCTCTTTCTCGACTGGTTCGGGGCCGTGTACT 58 MR1937 Reverse 174462 174554 93 148.5 GGUCGACCUUUUCACGUUGACC ACCUGCUUCUCUUUCUCGACUG
324 CGTTTGGTTTCTTGTCTGTTAACCGCTCGACAACCCTGACTGCGGTATGTGCAATATTCAGTCCAGTCAGAGCCGTCGAGCGGTAGACAGATTGAGATCAATGACG 64 MR1944 Reverse 175432 175537 106 147.0 CGCUCGACAACCCUGACUGCGG GUAGACAGAUUGAGAUCAAUGA
325 CGTAAAGCATGCAACTTGAGATGTCTTCTTCTTGATCTGCAGCTATCGACGTAGCCTGAAGAGATTATCTGGTGGCTGACGATTGGAAAGACGACGTCCTCTATCTCCATGACCGCG 165 MR1972 Reverse 178118 178234 117 132.7 AUGUCUUCUUCUUGAUCUGCAG UCUGGUGGCUGACGAUUGGAAA
326 CAATTTTCCCGTTGTGCATGCTTCGGATAAATGTCAAATGATCTTCGAGATCTAACGAACTGAAGAATCTTGACTTGTGTGACATGCCACCGTAGTGTTG 289 MR2070 Reverse 186488 186587 100 119.2 AAAUGUCAAAUGAUCUUCGAGA AAGAAUCUUGACUUGUGUGACA
327 GGTTGGCTGGGTGCCAAGTGGGTTGGCTGGGTGCCGCGGTTGCCGTAGCGATGGCTTCACTATTTTGGCGGTCTGTAAACC 253 MR2094 Reverse 189269 189349 81 121.5 UGCCAAGUGGGUUGGCUGGGUG CGAUGGCUUCACUAUUUUGGCG
328 GGCTGGGTGCCAAGTGGGTTGGCTGGGTGCCAAGTGGGTTGGCTGGGTGCCAAGTGGGTTGGCTGGGTGCCAAGTGGGTTGGCTGGGTGCCAAGTGGGTTGGCTGGGTGCCAAGTGGGTTGGCTGGGTGCCAAGTGGGTTGGCTGGGTGCCGCGGTT 195 MR2096 Reverse 189309 189465 157 128.2 UGCCAAGUGGGUUGGCUGGGUG UGCCAAGUGGGUUGGCUGGGUG
329 GGTGCGGGCGGCGGCGGCCTCTGCGGCGGCGTCCAGCGCATGGCGCTGAGCCTGCCGGGCCGCGAGTGCCAGACGCGCT 247 MR2130 Reverse 193788 193866 79 121.6 CGUCCAGCGCAUGGCGCUGAGC UGAGCCUGCCGGGCCGCGAGUG
330 GGTGCGGGTGCGGGCGGCGGCGGCCTCTGCGGCGGCGTCCAGCGCATGGCGCTGAGCCTGCCGGGCCGCGAGTGCCAGACGCGCT 220 MR2131 Reverse 193788 193872 85 124.7 GGCGGCGGCGGCCUCUGCGGCG CAUGGCGCUGAGCCUGCCGGGC
331 GCCGCCCGCCGCCGTGCAGAGCGCCCGGCAGCTGGGCGCCGCCTGGCGCACGCTGAGCCGCGAGGCGCGCCAGGCGCGAGAGGCGCGCCAGGCGGCGGCGGGCGGGGGCGCGGGAGGGCCGGGAGCGGGTGCGGGTGCGGGTGCGGGCGGC 328 MR2134 Reverse 193855 194005 151 116.4 GCGCACGCUGAGCCGCGAGGCG AGGCGCGCCAGGCGGCGGCGGG
332 GGCGGCCAGGGCGGCGGCGGCGGCGGCCACGGCGCCCAGGACAGCCAGCAGCCGGCCGGCGGCGGCCCCTGCGGCGCGGCCCTGGCCGGGCCCTGCTGCTGCGACTGCAGCTGCC 66 MR2136 Reverse 194019 194133 115 146.8 AGCCGGCCGGCGGCGGCCCCUG GGCGGCCCCUGCGGCGCGGCCC
333 GCCGACGACGCCGCGGCCAGCCGCGGAGAGGGCGCCGGCGGCGAGGTCCGCGGCCACGCCGGCGGCCAAGGCGGCCAGGGCGGCGGCGGCGGCGGC 316 MR2139 Reverse 194107 194202 96 117.4 CGAGGUCCGCGGCCACGCCGGC CCGGCGGCCAAGGCGGCCAGGG
334 CGACGCCGGAGCCCCCCATCGCCGCGGCGCCGTCAACGTCGTCTGCGGCGGCGGCCGCGGAGAGCCCGGCCGGCTCGGGGGCCGAAGCCGGGGACGACGCCGACGACGCCGCGGCCAGCCGCGGAGAGGGCGCCGGCGGCG 121 MR2141 Reverse 194160 194300 141 138.7 CCGGAGCCCCCCAUCGCCGCGG GGGACGACGCCGACGACGCCGC
335 CGGCCGCTGCCGCGGCCGCCGCTGGAGACGACGCCGGAGCCCCCCATCGCCGCGGCGCCGTCAACGTCGTCTGCGGCGGCGGCCGCGGAGAGCCCGGCCG 28 MR2142 Reverse 194229 194328 100 162.6 CCGCCGCUGGAGACGACGCCGG UCUGCGGCGGCGGCCGCGGAGA
336 GTTCCGCGCGCGCGACTCGCGCGAGCTGCTGCGGCCGCTGCCGCGGCCGCCGCTGGAGACGACGCCGGAGC 279 MR2143 Reverse 194289 194359 71 119.7 UGCUGCGGCCGCUGCCGCGGCC CCGCCGCUGGAGACGACGCCGG
337 GTGGCCGCCCGGCGGCTGAGCAAGTTCCGCGCGCGCGACTCGCGCGAGCTGCTGCGGCCGCTGCCGCGGCCGC 132 MR2144 Reverse 194310 194382 73 137.7 CCGGCGGCUGAGCAAGUUCCGC CGAGCUGCUGCGGCCGCUGCCG
338 GCGCGGGCGCCGTGGGCGGCGGGCGCAGCGGCGAGCGCGACGCCGGGCTGCGGGCCCGCGACGCCGAGCTCCTGGGCCTGCCGGGGCTGTGCCAGCGCTCGCCGCCCCGCAGCCCGGCGGCGGCGCTGTCGCACGCGCTGCGCCACGACCGCGACCGCTGGCGGCCGACGC 82 MR2145 Reverse 194460 194630 171 145.2 CGUGGGCGGCGGGCGCAGCGGC CGCUGCGCCACGACCGCGACCG
339 CCGCTTCCAGGGCCTGGCGGCGGGCGCGGGCGCCGTGGGCGGCGGGCGCAGCGGCGAGCGCGACGCCGGGCTGCGGGCCCGCGACGCCGAGCTCCTGGGCCTGCCGGGGCTGTGCCAGCGCTCGCCGCCCCGCAGCCCGGCGGCGG 60 MR2147 Reverse 194508 194653 146 147.3 AGGGCCUGGCGGCGGGCGCGGG CCGCGACGCCGAGCUCCUGGGC
340 GCGCAGCGGCGAGCGCGACGCCGGGCTGCGGGCCCGCGACGCCGAGCTCCTGGGCCTGCCGGGGCTGTGCCAGCGCTCGCCGCCCCGC 35 MR2148 Reverse 194521 194608 88 155.4 CGCCGAGCUCCUGGGCCUGCCG CCUGGGCCUGCCGGGGCUGUGC
341 GCTGTGCGCCGTGTGGGCGTACTGCACGCTGGACGGGCAGCTGTACCCGCTGGCCGACGACCTGGGGCACCTGCTGCGCGCCGGCACGCTGTCGCTGCTGCACCTGGGCCGCACGGC 235 MR2153 Reverse 194810 194926 117 123.2 ACGCUGGACGGGCAGCUGUACC UGGGGCACCUGCUGCGCGCCGG
342 AGCAACCTGCCGAAGGAGTCGATCGCGCGCGTGCCGCTGGTGGCGCTGCTGGACGAGCTGTGCGCCGTGTGGGCGTACTGCACGCTGGACGGGCAGCTGTACCCGCTGGCCGACGACCTGGGGCACCTGCT 97 MR2154 Reverse 194852 194982 131 142.7 UGUGCGCCGUGUGGGCGUACUG UACUGCACGCUGGACGGGCAGC
343 TCTGCTCGCACGCGCGGCCGGCCGAGCTGGTGGAGGCGGCCCGGCGCCACGTGACGCAGCGGCTGTGCTGCGCCTGGTACCCGCTGGCCGTGGTGCTGAGCAACCTGCCGAAGGAGTCGATCGCGCGCGTGCCGCTGG 153 MR2155 Reverse 194943 195080 138 134.1 CGCCACGUGACGCAGCGGCUGU ACCCGCUGGCCGUGGUGCUGAG
344 GGCCCTTCTGCTCGCACGCGCGGCCGGCCGAGCTGGTGGAGGCGGCCCGGCGCCACGTGACGCAGCGGCTGTGCTGCGCCTGGTACCCGCTGGCCGTGGTGCTGAGCAACCTGCCGAAGGAGTC 81 MR2157 Reverse 194963 195086 124 145.3 CGAGCUGGUGGAGGCGGCCCGG CAGCGGCUGUGCUGCGCCUGGU
345 CGCCGGGCCGGCCGGCGCAGACGGCGGTGCTGTGGCCGCGCTGGTCTGACCTGCGGAACGTGTGGCCCTTCTGCTCGCACGCGCGGCCGGCCGAGCTGGTG 181 MR2159 Reverse 195049 195149 101 130.3 GGCGGUGCUGUGGCCGCGCUGG CGUGUGGCCCUUCUGCUCGCAC
346 TGTACGCGTGCGACCTGCTGCCCCGCAGCACGACGGAGCCGGCGCGGCTGAGCGAGGCGCTGGCGGCCGCCAGCCGCGCGGCGCACGCGGCGCACGCGGTGGCGGAGGCGCACGCCGGACA 50 MR2160 Reverse 195167 195287 121 149.6 GAGCCGGCGCGGCUGAGCGAGG GCCGCCAGCCGCGCGGCGCACG
347 CGCCGACGAGTTCTTCCGCTTCGGACTGGGCGGCGTGTCGCGGCTGTACGCGTGCGACCTGCTGCCCCGCAGCACGACGGAGCCGGCG 263 MR2163 Reverse 195244 195331 88 120.7 UCCGCUUCGGACUGGGCGGCGU UGCGACCUGCUGCCCCGCAGCA
348 CCACGCGGCGCTGGTGCCAGCGCGAGCAGGGCGGCGTGCTGCCCCTGGGCCGGCCTCACGGGTTCTTCGCCGTGGTGACTCCGCGCTCGCAGATGCCCGGCGTGG 255 MR2168 Reverse 195573 195677 105 121.4 CUGGGCCGGCCUCACGGGUUCU CGGGUUCUUCGCCGUGGUGACU
349 GATGAGCGGCGGCGCGGAGCCGGGGCGGCTGTCGGCTGGAGCGGCCGCTCCGTCCGCTCCGTCCGCGGCGTC 134 MR2173 Reverse 195785 195856 72 137.6 GGCGGCGCGGAGCCGGGGCGGC CCGCUCCGUCCGCUCCGUCCGC
350 GTTCGAACCCCTGGGTGTTCCCGTGGCCGGCTGCCGGCTGGCCCCTGCCCTGCTGGTGGGCGCCTTGGCCGACAGCCGCGTCCAGGGAACCTGAGTGCGCGAGC 262 MR2181 Reverse 196162 196265 104 120.9 UGGCCGGCUGCCGGCUGGCCCC CGCCUUGGCCGACAGCCGCGUC
351 GCGGGAGCCGACTGTGCGGCCGACTGTGCGGCGGCCTCGGCCCCTGCGCCCTCCGCTGCCGTCCCGGCGCTCCTGC 336 MR2183 Reverse 196356 196431 76 115.9 UGUGCGGCGGCCUCGGCCCCUG CUGCGCCCUCCGCUGCCGUCCC