Chershoee
S.No. Sequence Rank Name Orientation Start end size Score 5`Stem 3`Stem
1 TTACACCCCGAGGTACAATTTGGAGAAAGGTCGATTCGCTGCTGCGCTTCGGTGGAGCAGCTCGTCGGCCTCCTCCGAGGTAAGGATTGTAA 3 MD25 Direct 2979 3070 92 123.7 UUUGGAGAAAGGUCGAUUCGCU CAGCUCGUCGGCCUCCUCCGAG
2 TCTTTGTATAAACAGCCTAACTTGCCCCATTTGTCTGTGATTAAGCGCTTGGCGGCCAGGTCGGAGGAGTTACCGTCCGTAGGTGATCGAGTCTTCTATGTCCTGACGGCCGCTCCGGTCGACGTGCGTCGAAAGATGAACAACTACGAATTGGCGGAAGACCCACTGTTTGTGAAAGA 1 MR4 Reverse 191 369 179 141.0 GCCCCAUUUGUCUGUGAUUAAG GCGGAAGACCCACUGUUUGUGA
3 GTGTTGGTTTTTGATTTTGCCAGCCTCTACCCTTCCATTATCATGGCACATAACCTGTGTTATTCTACGCTCATCATGGATAACGGGGAATGCCCTGATGAGGAAAAAGTGTATGAGGTCAGGTTTGAGAATGGCACAACAT 5 MR18 Reverse 1209 1350 142 118.8 UGCCAGCCUCUACCCUUCCAUU AUAACGGGGAAUGCCCUGAUGA
4 GGTATGAGGTGCGGGCACGTGGGAGGGTATCTACTTGTGATTTTGAGATAGACTGTGAAATCTCAGATCTCTTTTGCAGTTCTGAAGATACCTCTTGGCC 2 MR33 Reverse 2249 2348 100 131.6 GAGGGUAUCUACUUGUGAUUUU AAAUCUCAGAUCUCUUUUGCAG
5 GCCTGTGAAGAAGATGTCCATCTACGGCTATGGTACTAGTTGTGTTCCACACTTACACCGTGTGTCTATTAGCAATTGGATCATGGCCAGGAAGATCGGACAGTATCTTTTAGAACATGGGT 4 MR36 Reverse 2436 2557 122 121.6 GUCCAUCUACGGCUAUGGUACU AUUGGAUCAUGGCCAGGAAGAU
6 GACCGAAGAAGTTCCTTCAAGATATCGGCGACACATCATTCCATCTGGAAATGTCATTCGTTTTTTTGGGGTGATGGAGAACGGTCGCAGTATCTGCGCGAACGTTTTTGGTC 7 MR40 Reverse 2670 2782 113 116.2 GGCGACACAUCAUUCCAUCUGG CAGUAUCUGCGCGAACGUUUUU
7 CGATTCGAGGTCGGGTGCGTTTCCATACTTATGATCAAGTGGATAGCGTCCTGAGCCTCGACACG 6 MR41 Reverse 2782 2846 65 117.2 AGGUCGGGUGCGUUUCCAUACU GAUAGCGUCCUGAGCCUCGACA