Chershoee
S.No. Sequence Rank Name Orientation Start end size Score 5`Stem 3`Stem
1 GCTGAGGGAGTGTTGCGTGACATAAGTAAGCGCGTCGGCGTCCTCAGCGCGTTTGCGGCGTGCTGTGTCCGGCGCTTTGTGCGCACTGCCGTTGCGTGGCGTCCCGCGGT 433 MD4 Direct 707 816 110 116.2 UCAGCGCGUUUGCGGCGUGCUG UGUGUCCGGCGCUUUGUGCGCA
2 CGGTGTTTGTGCGGCGTTTCTACGCAGCTTTTGCGCAGCGCTTCGCTTTTCGGGGCGGCGACGGCGTTGTTTTCGGGCGTGCTGGGCGCCGGCGCCG 90 MD6 Direct 888 984 97 146.0 ACGCAGCUUUUGCGCAGCGCUU CGGCGUUGUUUUCGGGCGUGCU
3 CGAGGGCGCAGCGCTCGGCTACCCCGTCCCCCGCGCGGAAATCCGCCGCGGCGGTGGCGACTGGGCCGACAGCGCAAGCGACTTCG 373 MD7 Direct 1675 1760 86 120.2 CGCGCGGAAAUCCGCCGCGGCG GCGGUGGCGACUGGGCCGACAG
4 TCATGGGCGGGCTGAAGACCGTGCGGGAAGGATTGACGTGTGCGGTGCTTGTGGAACACGGTGTTTTAATATGTATCCGCGTGTAATGCACGCGGTGTGCTTTTTAGCACTCGGTTTGATAAGCTACGTGGCCGTTTGCGCCGAAAACACGGTTACCACCAACTGTCTCGTGA 57 MD84 Direct 8531 8703 173 152.2 AUCCGCGUGUAAUGCACGCGGU ACGGUUACCACCAACUGUCUCG
5 GTCGTGAGCCAGACGGCCACGCGAGTACGTACGTGGTTTGTGCAAAGAACCACGTTGTGGCGTCGCACGTGGGTTCCGGGAC 150 MD183 Direct 20534 20615 82 137.9 ACGCGAGUACGUACGUGGUUUG ACCACGUUGUGGCGUCGCACGU
6 CTGGCCCGAGATCGTGCGTTCGCTGGTGGTGGACGCACGCAGCGGTCAGGTGTTACACAACGACGCCAGCTGTTACATCGCCGGCGGGCGCTGGCGTTTCGAGGACGG 134 MD199 Direct 21474 21581 108 139.4 CGAGAUCGUGCGUUCGCUGGUG CGCCAGCUGUUACAUCGCCGGC
7 AGCCTGGCGACCGAGACCACGGCGCTGGTGGCCGACGTGCACGACCTGCGCCACTCGGACCGCTCCTGCGACCTGGCTTTCGGATCGCGCT 268 MD204 Direct 21670 21760 91 126.1 ACCACGGCGCUGGUGGCCGACG UGCGACCUGGCUUUCGGAUCGC
8 CCTCTGCCACCTGCTGTGCTACTGGTGTTCCGAATCGTACCGGCGTCTGAACACCGAAGAGGAAAACGAGGCGGCGGAGG 239 MD207 Direct 22062 22141 80 128.0 UACCGGCGUCUGAACACCGAAG CUGAACACCGAAGAGGAAAACG
9 CCGCCGTCGGTGCGCTCATCTGCGGCAGCGGTACCCGACGCGGCAGCGGCGCCAACGAACGCCGCGACTCCGACGTCGGTCCCATCGCCCACAGTAGCGGTACCAGACGCGG 454 MD210 Direct 22298 22409 112 115.3 CAGCGGUACCCGACGCGGCAGC CCACAGUAGCGGUACCAGACGC
10 GCGAATGAAACGTCCGCCTGTACGCGGACCGATCACCAGAAGGCGGACATTGGGCTGTGGTTCATGTTTCTGGTTTTTGGACTGTGTTCGTGGTTGGCGATGCGGTATCGC 99 MD213 Direct 22414 22524 111 144.5 AUUGGGCUGUGGUUCAUGUUUC UGUUUCUGGUUUUUGGACUGUG
11 GGTCGTCATGACCAGCAACGCCCTGTATGAGCTGTTTCGACGTCGGTTACCGCGTGCCCCCGTCAACACGGTCATGTTTCTCACGCGACGCACTCGTGATGGGTTCTGCGGTCGGTTGACGTCC 349 MD236 Direct 25073 25196 124 121.7 AUGACCAGCAACGCCCUGUAUG CAUGUUUCUCACGCGACGCACU
12 TGTGAGTCGCAGGGACGCGTGACACGAAACGCGTTCAGGATTAACGTAGGTTTTCGAAATAACCTACGTCCGTGAGTGACGCGGTTTCGTGTTGAAACCCGCGCCCGCTTCTCACG 56 MD237 Direct 25355 25470 116 152.2 CGCGUGACACGAAACGCGUUCA UACGUCCGUGAGUGACGCGGUU
13 TGGCTGTGCTTACATGCGGACTGCAGGAAGCTTATATACTCGACAAAGGTCGTAGATACATGTATTTGTTTTCCGTGTCCTGCGTGGGAATCACAGGTA 159 MD246 Direct 26229 26327 99 136.1 UUAUAUACUCGACAAAGGUCGU AUUUGUUUUCCGUGUCCUGCGU
14 GCGGACTGCAGGAAGCTTATATACTCGACAAAGGTCGTAGATACATGTATTTGTTTTCCGTGTCCTGCGTGGGAATCACAGGTACCGTATCTATTATACTCGTCTCCCTATCGCTGCTCATCCTCATCTGT 309 MD248 Direct 26244 26374 131 123.9 UAGAUACAUGUAUUUGUUUUCC GGAAUCACAGGUACCGUAUCUA
15 GGCGTAAACCGTCGAGGTTGAAAAACCGCGTATCTGCGACCCGTCCGGACTACGTTGTTTTTTAGAAGCGGCCACATGACCTCGA 413 MD263 Direct 27283 27363 81 117.3 UCGAGGUUGAAAAACCGCGUAU CGGACUACGUUGUUUUUUAGAA
16 TCGGCACGCGAAACACGGTTTCTTCCCATAGCCTGTCTAACTAGCCTTCCCGTGAGAGTTTATGAACATGTATCTCACCAGAATGCTAGTTTGTAGAGGCTATGCGGGATGCTGCGGCGGCGCGA 292 MD271 Direct 27955 28079 125 124.4 UUUCUUCCCAUAGCCUGUCUAA UAUCUCACCAGAAUGCUAGUUU
17 GCGAGTCAAACGGGAAGTAGCGTCGGTGTTTTATGCCCCAAGCAGCGTCGTCGTCACTCGTGGCGTCACAGTCAACGGTGCTGACGTCCTTTGGGGCAGTCGGGCACGCGATCGTAGATGCCGTTGTGGCCGC 52 MD284 Direct 29207 29339 133 152.9 AACGGGAAGUAGCGUCGGUGUU AACGGUGCUGACGUCCUUUGGG
18 GCGACATCGAAGACTTTGAGCGCGAATGTTACCGGGTCAGCGTGGCCGACAATCTGGGCTTCGAGCCCAGCGTGGTCGCGCCGCAGCACGTCGAGTATCTCAAATTCGTGCTGCAAGACTTTGACGTGC 389 MD301 Direct 30940 31068 129 119.1 GAAUGUUACCGGGUCAGCGUGG CGUGGUCGCGCCGCAGCACGUC
19 CGCGTCGCAGGCCCGAGCGGTTGCCGTGACGCAGTCTGCCCTGCGCAGCGCGCTCCACGTCTTCAAAGTAGCTGTGTAGCAGGCCGCGCTCCAGCAACTGCGGCAGCGAGTCGGCGGCGCG 190 MD317 Direct 32700 32820 121 132.4 GCAGUCUGCCCUGCGCAGCGCG UGUGUAGCAGGCCGCGCUCCAG
20 GCGGGGCCTTGCGGCGGCAGCGGTTGGCGTGGTTGCTCAGCTCGGCGTCCGAGAGCGCCGAGCTGAACTGCGGCAGCCGCGTGCGATCCTGCGGCGCGTCCCCGT 66 MD327 Direct 33310 33414 105 150.0 CGGUUGGCGUGGUUGCUCAGCU CGAGCUGAACUGCGGCAGCCGC
21 GCAGCGGTTGGCGTGGTTGCTCAGCTCGGCGTCCGAGAGCGCCGAGCTGAACTGCGGCAGCCGCGTGC 299 MD328 Direct 33326 33393 68 124.2 UCGGCGUCCGAGAGCGCCGAGC CGAGCUGAACUGCGGCAGCCGC
22 GGAATCCGCTGCACCAGCTCGAGAAAGTCGCAGAAGGTCTCCACGAACGTGTCCTCGGTGAAGCGAATGCGCTTCAGATCGTGGACGTGTTTGCGAAACCGCGACAGTTCTCGACGTTGCACGGGGTTCT 18 MD332 Direct 33552 33681 130 169.1 CCACGAACGUGUCCUCGGUGAA CAGAUCGUGGACGUGUUUGCGA
23 GCGTCTGCGACCAGTCGGCGAAGCCCAGGTCACGTGATACGCTGTCCTGGACGCGGGCCACGTCGCCGGCTGTGAGGTGGCGGATCGC 297 MD337 Direct 33913 34000 88 124.3 CACGUGAUACGCUGUCCUGGAC GACGCGGGCCACGUCGCCGGCU
24 GCGTGCTTGGGATGTTTGGGCGCCGGCGTTTTCCTTTTCTGACCGCCGGCGGCCGCCAGATCCTCGGGCGTGC 370 MD345 Direct 34707 34779 73 120.8 UUGGGAUGUUUGGGCGCCGGCG CCGGCGGCCGCCAGAUCCUCGG
25 CCGTCGTCATGGTCTTCTTTAGCCTGCTCCTCCGGCTGCTGGGTTAGCGGTGGAGGTGGCGGCTGATCCACGGGGTTCATGACTGAGAGG 234 MD347 Direct 34929 35018 90 128.5 UUCUUUAGCCUGCUCCUCCGGC CGGUGGAGGUGGCGGCUGAUCC
26 GCTTTTTGAACGGCAGTCTCAGCTCGGGATTGGCCTCGTACAGCGAGCTGCGGTCCACGGGGCCGATGCTCTCGTAGCGAAAGTCGTCGATGAGC 40 MD361 Direct 36282 36376 95 156.2 UCAGCUCGGGAUUGGCCUCGUA CACGGGGCCGAUGCUCUCGUAG
27 GGCCCGATGGTCGGGATGCACCAAGGGCACGTTAGGTTGCAGACGCGCGCAGATGGATTCGTGCACCGGGTCGCAGCGGATCATGCCCTTGGCAAAAAATCCGGCCAGATCCGAGGCC 162 MD369 Direct 36790 36907 118 135.7 GGCACGUUAGGUUGCAGACGCG ACCGGGUCGCAGCGGAUCAUGC
28 GATGGGCTCCGGGTCCGTCAACACGCGACCCGCGCGGCAAAAGGCACGCTGTTGACGGCGCGAGAGCCCGTC 169 MD382 Direct 37651 37722 72 134.8 UCCGUCAACACGCGACCCGCGC UGUUGACGGCGCGAGAGCCCGU
29 GCGCGTATCAGGAGCCGTCATCGCCGATGTCGTCATCGCCCTGACAGGCGCGTAGATGGCTCCGCGAGATCATGCGC 329 MD386 Direct 37813 37889 77 122.6 CAGGAGCCGUCAUCGCCGAUGU CAGGCGCGUAGAUGGCUCCGCG
30 TGGCGCCGGGCCTCGCGCAGGTCTCGCACGCGTTGTGAGCGGGAGGCGAGTTCGGCTTCTTGCTCGAACTCCTGCTGCTCACTGTCCGAGAGGGTGCGATAAAAGGCGGCA 427 MD390 Direct 37928 38038 111 116.4 UGAGCGGGAGGCGAGUUCGGCU AACUCCUGCUGCUCACUGUCCG
31 GGCAACGACGGCGGTGGCGGCGACCAGATTATGGGGGACAAGCCCACGCTTGTGACCCTGTTGACCGTCGCCGTGTCGTCGCC 350 MD396 Direct 38297 38379 83 121.7 GGACAAGCCCACGCUUGUGACC GACCCUGUUGACCGUCGCCGUG
32 TGGACGACGACGAGGCGGCGCTACCCGGCGAGGACGAGGCGTGGATCGCGTCCAAAAACGTACAGTACGAATTCATGGGTCTCATTTTCACCGTCAACGTGGATTCACTATGCGTGGACGCGGAACAGCGCCAACTGCTGGGCACCGTGGCCACCTCCTTCTGTCACCGCGTCTCGGACA 294 MD416 Direct 39396 39575 180 124.3 AACGUACAGUACGAAUUCAUGG AACGUGGAUUCACUAUGCGUGG
33 TCGGTGAAACGCGGATCTTGACGGTTGGGGGGATAGCCATCCGAGCTGTCGGAATCCTCGTCGCCCGA 138 MD435 Direct 41693 41760 68 139.3 AACGCGGAUCUUGACGGUUGGG CGAGCUGUCGGAAUCCUCGUCG
34 CGTCATCATCATCGTCGTCGTCGTCCTCATCGGCACTGGAGCCAAAGAGCCTCCGGGAGGCGCCCGGTTTACGTGTCGGGGGCGGCGGTTGCTGCTGACG 376 MD440 Direct 42030 42129 100 119.9 UCGUCGUCCUCAUCGGCACUGG CGCCCGGUUUACGUGUCGGGGG
35 GGCGTGCTTGAGGATATTGCGACAGTAGTTGGAATCAAAGGAAAGGCACATGCGCAGCTCCTTGACCAGCAGCTTGCAACGCTCCTGAATGCGCGCC 156 MD446 Direct 42574 42670 97 136.7 CAGUAGUUGGAAUCAAAGGAAA CUCCUUGACCAGCAGCUUGCAA
36 GGGGTAGTTTAATAGCGGAGGCGGATACGCGGTTTTCACCCGGGCGCCGCTGACTTGTTTCTTCTGTTTTTTACTCC 332 MD453 Direct 43467 43543 77 122.4 GGAGGCGGAUACGCGGUUUUCA CGCUGACUUGUUUCUUCUGUUU
37 CGCTGCTGGGTCATGACTTTCTGCAGCGCATGCGGCAGTGTTTCCGCGGCCAGTTGCTGGACCGCCGCGCTTTCCTGAGATCGCAGCAGAATCAGCGAGCTACAGCG 436 MD463 Direct 44454 44560 107 116.1 CAGUUGCUGGACCGCCGCGCUU AGCAGAAUCAGCGAGCUACAGC
38 GGACGCCGACGGCCAATCGCGTGGCGTAGGAGTGGCGCCCCGGCTTCATTATAACGCCACGTCGGAGCCCCTGCGCGCC 377 MD467 Direct 44885 44963 79 119.7 CAAUCGCGUGGCGUAGGAGUGG AUUAUAACGCCACGUCGGAGCC
39 GTCCCCTCCTTAATCAGTTGTTCATGTAGGCGTGTGGCGGGGTGAGGGGCGGCATGCCGTTGGCGGCGCCGGGAATAATGTGCCGTCGACCGACGTCGCACACCTTGAAACGCCGTCGGCGCACGCAGCGGTCGCAGGACGGGAT 289 MD509 Direct 48582 48726 145 124.6 UCAUGUAGGCGUGUGGCGGGGU CCGUCGACCGACGUCGCACACC
40 GGCAGCGACAGCTCGTCGTCGTCATCCTCGTCAAACATGATCATGGGGTCAGGGGTTTTTTTGGGATGTTGACAGGTGGGTGTCTTTTCC 186 MD517 Direct 49016 49105 90 132.9 CAUGAUCAUGGGGUCAGGGGUU GGGGUUUUUUUGGGAUGUUGAC
41 TCCACGCACGTTGAAAACACCTGGAAAGAACGTGCCCGAGCGAACGTCCTCTTTCCAGGTGTCTTCAACGACGTGGG 206 MD526 Direct 49844 49920 77 131.1 AAACACCUGGAAAGAACGUGCC UCUUUCCAGGUGUCUUCAACGA
42 GGAGTCTGTGGTTTTTTTGTTTACCCCTGCTTACTGGTGAGACTGCTGGGGGCCGTTGTGCTGCAGCAGCCGAGCTCGTCGCCGCCGTTGCCACAGGAACCGGTGCCTCCGCAGGGCCTTTTTGAGAGCCTCGCAGGCTTC 411 MD558 Direct 52539 52679 141 117.4 UUACUGGUGAGACUGCUGGGGG CGCCGCCGUUGCCACAGGAACC
43 GTGTTGCTGGAGGTCTGGCGGCAGCAGTACACGTCGAGCGTCATGAGGACCATGTCGCCTTGGTGGTACACGGCGTACGCCCAACCCTGGAACAC 113 MD573 Direct 53968 54062 95 142.4 CGUCAUGAGGACCAUGUCGCCU UGUCGCCUUGGUGGUACACGGC
44 CATGCCGATGCAGACGTTCATGTCGACGTAGCCGGCGGTGCTGTTGGCGGTGCGGCAAAAGAGTGTCATGTCGTGCGTGCA 375 MD576 Direct 54569 54647 79 120.0 UAGCCGGCGGUGCUGUUGGCGG GGUGCGGCAAAAGAGUGUCAUG
45 GGCGGGTACGGCCGCGGGTGTCCGCGGACACGTTAGTTATACACGGAATTGAGTCACGTGGCACGTTGCCAGCTGAAACCGCC 341 MD593 Direct 56346 56428 83 122.1 CGGGUGUCCGCGGACACGUUAG UUGAGUCACGUGGCACGUUGCC
46 TTGCAGCCGTCCCCGGGTCTCTTCCCACGTCAGGTACATGTCTTTCGGTATCATCAACGCGAACACCTCCGTTTTGAGCGTGTTGTAAAGGTAGCCGCGCATGACGCAGGTGAGCAACGAGGTGATGCCCAGCGAGACGGTCTTGACGCAGCCCAGCGTCTCGAGGCGGCGGTGCAG 311 MD631 Direct 61130 61306 177 123.9 UCAGGUACAUGUCUUUCGGUAU AGCGUCUCGAGGCGGCGGUGCA
47 ACGTCAAGAACAGCGTGCGGCACATGAGCTCTTTCGTCAGTTCCGATATCGACGGCGACCAGAAGCCCGGTGCCGAACACATGCGTGACGT 453 MD648 Direct 62455 62545 91 115.4 UGCGGCACAUGAGCUCUUUCGU CGGCGACCAGAAGCCCGGUGCC
48 GCGCCAACCTAGACGCTTACGCGCGCGTGTGCGATCGCGTGCTGGAAGACCACTTGCATACGCCGCGACGCGTGCAACGGCTACTAGATCTGACGC 163 MD649 Direct 62713 62808 96 135.5 UGGAAGACCACUUGCAUACGCC UACGCCGCGACGCGUGCAACGG
49 GTGCCACGGAGGCGGAGCGCGAGTACCTGTATCGGGACCTGCACAGCAAGTGGGGCGTGCACCTGTTTACCTTGCGTCCGTCTCGCGGCGC 293 MD653 Direct 63160 63250 91 124.4 UGCACAGCAAGUGGGGCGUGCA UGCACCUGUUUACCUUGCGUCC
50 ACCTGTACACCACCGTCAACCCGCTGATCGAGGACGTGATGCGCAGCAGCGCCGGCAGTCTGAGAAACTATCTGCGACATACGCGACTCTGTTTCGGTCTGGCGCGTGGCCGGGCGCGCCTCTCGGAGGACGGCGTGACGGTGTACGTGGAGGT 338 MD667 Direct 63721 63874 154 122.2 CGAGGACGUGAUGCGCAGCAGC UCUGUUUCGGUCUGGCGCGUGG
51 GACACGGCTATCATGCGCAACAGGTCCAGCTTAAAGGCGCACTTGTCGTTAAACAGACTGGACATGCGCGTATACTTGCTC 351 MD736 Direct 71485 71565 81 121.7 AUGCGCAACAGGUCCAGCUUAA UUAAACAGACUGGACAUGCGCG
52 TGTTTTTCGTCCCGCTTGTTGGCCACCGTGGGTCCCGGCGCGGTGTTAGACATGGGGCAGGCCGTGGGGGGAGGACG 256 MD739 Direct 71644 71720 77 126.8 UUGGCCACCGUGGGUCCCGGCG GGGCAGGCCGUGGGGGGAGGAC
53 GAGCGTCTCGGAGACGAGCTCGTAGACGCGCTGCCGCACTACCCGCTGACTGCCGCAGAGCGAGCAGTGTACGAGCTCGGCGTGCGTGTTGAAGATGACGCTCTTTTCTTGACGGTC 403 MD749 Direct 72076 72192 117 117.9 AGCUCGUAGACGCGCUGCCGCA AGUGUACGAGCUCGGCGUGCGU
54 TTTGCTGGCAGTGTAGCTTTTCCTTACCCAGGTTGAGGCAGTGTCCGCACTGCCGACAGA 168 MD752 Direct 72225 72284 60 134.9 UCCUUACCCAGGUUGAGGCAGU AGGCAGUGUCCGCACUGCCGAC
55 GACTGCATCACGCAGATGCTCACGGCGGCGCGCGAAGACTACAGCGTCACGCTCAACATCGTGCGCGACCACGTCGTTATCAGCGTGCTGTGTC 448 MD805 Direct 77728 77821 94 115.6 CGCAGAUGCUCACGGCGGCGCG CAUCGUGCGCGACCACGUCGUU
56 CCACGTCGTTATCAGCGTGCTGTGTCACGCCGTCTCGGCCAGCAGCGTCAAGATCGACGTGACTATTTTGCAACGCAAGATTGACGAGATGG 383 MD808 Direct 77796 77887 92 119.4 UGUCACGCCGUCUCGGCCAGCA GACGUGACUAUUUUGCAACGCA
57 GCGCTCTAGCATGTCGCGACCGATGCGCGTAATGCTGGCGGCGATGGGCAGACACGGCATCATGCCGTTGACCACGCCGGTAAAACCGTAGAAAGCGTTGCACGTTACTTTGAGCGC 416 MD817 Direct 79382 79498 117 116.9 ACACGGCAUCAUGCCGUUGACC UUGACCACGCCGGUAAAACCGU
58 GTCCAAAGAATCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTGGTCCCGGTCCTTTGCGAC 379 MD847 Direct 82180 82325 146 119.6 CUGCGUCCAGACGGGCCAGGGC AAGCCUGCUCGUUGGUGUAAGG
59 TCTGTACCGTTCTGCTGCGCTCGCTGCTCTGCGTCCAGACGGGCCAGGGCCAGAAGCATCTGGTAAGCCTGCTCGTTGGTGTAAGGCGGAGCCGCCGTGGATGCATCAGACGACGGTG 33 MD848 Direct 82190 82299 110 160.4 UUCUGCUGCGCUCGCUGCUCUG AAGCCUGCUCGUUGGUGUAAGG
60 GGTAGGCGCGTTTGCGCACGTTCACCTCGCGGGTGACGTTGTGGATGCGGGAACGCGCGTCCACCAAGTCGAGAGCTTCGTGTTCGTCGCAGTTGCGCACCC 422 MD887 Direct 85738 85839 102 116.6 AUGCGGGAACGCGCGUCCACCA CGUGUUCGUCGCAGUUGCGCAC
61 TCGCGGGCCGCTCGCTATGCCGACTGACGTTGACGTTAATATATAACGACGTCGTCGACGACGCGGGTTCTGCTCCCGA 417 MD901 Direct 87383 87461 79 116.8 GACGUUAAUAUAUAACGACGUC GACGUCGUCGACGACGCGGGUU
62 GCTGTTGCGGCGGTAGCTGATACGGTGTCGCCTGGTGCTGCTGTGTCGGTGGCTGCTGTTGCTGC 160 MD906 Direct 87704 87768 65 136.0 UGCGGCGGUAGCUGAUACGGUG CUGUGUCGGUGGCUGCUGUUGC
63 CTGTTGCGGCGGTAGCTGATACGGTGTCGCCTGGTGCTGCTGTGTCGGTGGCTGCTGTTGCTGCTGTTGTTGCGG 223 MD907 Direct 87705 87779 75 129.3 UAGCUGAUACGGUGUCGCCUGG GUGGCUGCUGUUGCUGCUGUUG
64 AGCGGCCACGGGGGCTGCGACTGTTGCTGCTGTTGTTGCGATGCTCGTGGCTGCGGCGGCCGTTGTCGCGGCGTTTGCTGGCGGTT 32 MD910 Direct 87787 87872 86 160.5 GGCUGCGACUGUUGCUGCUGUU UGCGGCGGCCGUUGUCGCGGCG
65 ATGGGACGGCGTTTCCGTGCGCATGCGCAGTCGGGGCGAATTTTCGGTTGTTAGGGCGTTGCCACGCGGATTATGGGATGTGGCCTCGAGTGCGCATGCGCCGGGGATGTCGTATAAAAAGCCTAT 37 MD965 Direct 93865 93990 126 158.6 UUUCCGUGCGCAUGCGCAGUCG GAGUGCGCAUGCGCCGGGGAUG
66 TCCCCGGCCGAGGCCCGGCGCCGGTCCGTCCGCGGGCCCGTCCCACCGCCCTGGAGCACCATCCGGGGCCGTGGGCCGGGCACCGGGCGCGGCCCGCTCCGGACCTCGGCCGGGGG 1 MD972 Direct 94411 94526 116 222.3 CCGAGGCCCGGCGCCGGUCCGU GGGGCCGUGGGCCGGGCACCGG
67 GGACCTCGGCCGGGGGTCCCTGCCCTCCCCCCGCTCGACCCCCCATCCGACGGCCCGGCCGGGCTGGGACCCCCGCACCGGGGTCC 44 MD973 Direct 94511 94596 86 155.1 UCCCUGCCCUCCCCCCGCUCGA GCUGGGACCCCCGCACCGGGGU
68 CCCCCGCTCGACCCCCCATCCGACGGCCCGGCCGGGCTGGGACCCCCGCACCGGGGTCCCGGTTCCCGTCCGCGGCCCGGGGGGACCCGAGCGGGGG 38 MD974 Direct 94538 94634 97 157.8 GACGGCCCGGCCGGGCUGGGAC UCCCGGUUCCCGUCCGCGGCCC
69 GGTTCCCGTCCGCGGCCCGGGGGGACCCGAGCGGGGGCTTCCCACCCCCACCCCGCTCCTCCCCGGGCTCCGGCCCGGGATCC 171 MD976 Direct 94598 94680 83 134.5 CCCGGGGGGACCCGAGCGGGGG CUCCUCCCCGGGCUCCGGCCCG
70 GGCTTCCCGGTCCACCCGCCGCGGAACGGACGGGACCCGGGGTCCGCGCCCTTCCCCTCCCCCCACGGGGGGCTGGGTCGCGGACCCCGGTTCCTAGGCTCGTTCCGCGGTGGGCGACCGGGGATCC 8 MD978 Direct 94706 94832 127 179.5 ACCCGGGGUCCGCGCCCUUCCC GCUGGGUCGCGGACCCCGGUUC
71 GGGGGGCTGGGTCGCGGACCCCGGTTCCTAGGCTCGTTCCGCGGTGGGCGACCGGGGATCCCCCACCCAGCTCCCC 62 MD979 Direct 94772 94847 76 151.7 UCGCGGACCCCGGUUCCUAGGC CCGGGGAUCCCCCACCCAGCUC
72 GGCCCGCCCCGCTGGCTTTTGGGCCCCTCCGGGCTTTTTTTTTCCGGCTGGGGGTCGCGGCGGTCGGCCGACGACGACGGTAGGTGGGCCGGGTGGACGGTGGTGGGGACGGGCGACGCCCCGGCTCGACGGCAGTCGGTCCCGGAAGGTTGGGGGCTGGGGGCCCGGTCAGGAGCTTCGGGAGCGGGGTCGACCGCGACGGCTTCCGGGTCTCGCGGCGGCTCCCTCTCGGCGGCTCCGGTTGGGCTCCCCTCCCCCCTCTCGAGGGTCCGGCCGCCAGTCGTGACCGGGGGTCCCTCGGCCTAGCCGCCGGCTCTCGGTCCGCCTTATCCTGGGCGTTGGCCGGTCCCGTGACGCTCCCCTCCCCCACTGCTCCCCAAAAAAACTCCGCCCGAACCGTCGCGGCTTGCTGGCC 3 MD981 Direct 94853 95267 415 195.9 GCUUUUUUUUUCCGGCUGGGGG CGCGGCGGCUCCCUCUCGGCGG
73 CGTCGCGGCTTGCTGGCCCTGGGCGTGGTCCCCCACTCCCCTCCCCCCATCGGCCGCCCAGCCGGGGTCGGCGCCTCGGACCCCACCAGGCTGTGGCGTGTGTGCTGGCCGATGCGGCGGCGAGGTTGGGTGTGGCCGGAAGCGCTCGGGGTCGACGGTGGGCCGCCATGAC 274 MD983 Direct 95250 95419 170 125.4 CAUCGGCCGCCCAGCCGGGGUC UCGGACCCCACCAGGCUGUGGC
74 TCGGCCGCCCAGCCGGGGTCGGCGCCTCGGACCCCACCAGGCTGTGGCGTGTGTGCTGGCCGATGCGGCGGCGAGGTTGGGTGTGGCCGG 93 MD985 Direct 95299 95388 90 145.3 CGCCUCGGACCCCACCAGGCUG UGUGCUGGCCGAUGCGGCGGCG
75 TCCCCGTGGGCTCCACGCGTTTTCCACCCTTTCCTGGAGGGGTCCGGAACACCGTGAATCCACGGGGA 139 MD987 Direct 95537 95604 68 139.2 UCCACCCUUUCCUGGAGGGGUC UCCGGAACACCGUGAAUCCACG
76 AGCGAAAAAATGATAGCCCTGAAAATCTCGACGAGTCTGGCCGAGCGGCGCCATCTTGGAGGAGGGGCGAGTCGCGGGCACCGCCTCGGTACCCCCTGGCCGAGGCGAGTCCGCGGTCGCCGCCTGTTCCGTGATGCTACCTAGAGGGCGCTGTCGAGGCGACTCTTCCTGTTTTCGCCCTGAGGGCTAACGGTCGCT 121 MD993 Direct 96082 96279 198 140.6 AUAGCCCUGAAAAUCUCGACGA GCGAGUCCGCGGUCGCCGCCUG
77 CATCGCAGGCCAGAGGCTAAGCCGAAACCGTCCGGGGAAGCGGGCGCGAGTTTTCCGACTTAGCCTTTGGTGCTCGTTG 204 MD1014 Direct 98207 98285 79 131.2 CCAGAGGCUAAGCCGAAACCGU CGACUUAGCCUUUGGUGCUCGU
78 CCTCGTACGACGGGGCCCTCGCTCGTCGTGCCTCTTCCCCCCTCCGGGAGAGGGGACGTCGGGGCCCTCCGTCGCACCGGG 195 MD1015 Direct 98596 98676 81 131.7 CUCUUCCCCCCUCCGGGAGAGG AGAGGGGACGUCGGGGCCCUCC
79 GGCAGCGCATTACCACCGAGTCGTCTTCTTGCGGTACCGGTGGTGGCGGCGGCGGCTGCTGCTGTTGGGTTGCCGTCGTACTGTGATTACCGTTGGCGGACTGCACCGGGATGATGGGCTGCT 86 MD1026 Direct 99572 99694 123 146.4 ACCACCGAGUCGUCUUCUUGCG UGGGUUGCCGUCGUACUGUGAU
80 GTCGTCTTCTTGCGGTACCGGTGGTGGCGGCGGCGGCTGCTGCTGTTGGGTTGCCGTCGTACTGTGATTACCGTTGGCGGACTGCACCGGGATGAT 196 MD1027 Direct 99591 99686 96 131.7 UGCUGCUGUUGGGUUGCCGUCG UUGCCGUCGUACUGUGAUUACC
81 CGGTACCGGTGGTGGCGGCGGCGGCTGCTGCTGTTGGGTTGCCGTCGTACTGTGATTACCGTTGGCG 317 MD1029 Direct 99603 99669 67 123.5 CCGGUGGUGGCGGCGGCGGCUG UGCCGUCGUACUGUGAUUACCG
82 CGTAGTGGGGGTTAAGGGGCACCGAGGCGGACGCGGCCACGCGTCGCTTGAAAGAGGAGGACGCCCTATGTCCGCCACGGAAGCCCGCAGTGCCCATGATG 185 MD1052 Direct 101294 101394 101 133.0 AGGCGGACGCGGCCACGCGUCG GGACGCCCUAUGUCCGCCACGG
83 CCGCCGGTGCCCCCGAGTGCGTGGCGGGAGGAGGGTGGAAGGGGAGGAGGATAGTGGTCCGGATCGCCTTCGGTATCATCGTCTTTGCTGTAGCGGGGTCGTCGTGCGG 71 MD1055 Direct 101401 101509 109 149.2 CGGGAGGAGGGUGGAAGGGGAG AUCGCCUUCGGUAUCAUCGUCU
84 GTCGGTGATGATGCGAGGCGGCGCCGACGGTATCTTCCGCGAGATGGTATTCGCTGGCGGCTGCTCCGTTCCGTGTCGAC 157 MD1059 Direct 101519 101598 80 136.7 GAGGCGGCGCCGACGGUAUCUU UGGUAUUCGCUGGCGGCUGCUC
85 TGCGCGCGCCGTCGCGTCGCTTGACGGCCACGCAGCAGGCGCCGTGGGGCTGAAAGAGGAGGACGTGGGGCGCGGTA 446 MD1066 Direct 102062 102138 77 115.7 CACGCAGCAGGCGCCGUGGGGC UGAAAGAGGAGGACGUGGGGCG
86 CTGCTCGCTGACGTGCGGTTCGTAGTGTTGCGTGAGGTGCTCGAGCAGCGGCGGCCACACGCGGGTGACGACGAGCCGCTGCAAGTCCGTGTCGG 306 MD1068 Direct 102141 102235 95 124.0 CGGUUCGUAGUGUUGCGUGAGG CCACACGCGGGUGACGACGAGC
87 GGCGAGCACCTCGGTGAGACCGCGGCGTCGATAACGCGTCACGTTAAGCGAGCGCGTCTCGATAAAGTTGGCTTCGGTCGAGGGGCAGATTTTGTCGCGTACGCTGAGAATGACGCGTGGCGGCGGTGACAGGGGCAACGCGGGCAGGTC 41 MD1069 Direct 102279 102428 150 156.0 AGCGCGUCUCGAUAAAGUUGGC AGAUUUUGUCGCGUACGCUGAG
88 GGCCGCGTCTCGGCCTCGTCCAGACTGGCGATGAGCGCCGAGAGGGGGATGGGCTGGCGCGCGGCC 249 MD1095 Direct 104401 104466 66 127.1 CGUCUCGGCCUCGUCCAGACUG GAGAGGGGGAUGGGCUGGCGCG
89 GTTCCTCAAGGGCTATCTCTCGGAGGGCTGTTTGCCTCACACGCGGCCGGCGGCCGAGGTGGAGTGCAAGAAATCGCAGCGTATCCTAGAGGCCCTGGAC 362 MD1102 Direct 104951 105050 100 121.0 GGCCGGCGGCCGAGGUGGAGUG AGCGUAUCCUAGAGGCCCUGGA
90 GTTATGAGGTTCGACCAGCGGCTGCTGGAAGAGGGCGACGAGGAGGATGAAGTGACCGTGATGTCGCCGTCACCCGAGCCCGTGCAACAGCAGCCGCCGGTCGAGCCCGTGC 221 MD1107 Direct 105420 105531 112 129.3 UUCGACCAGCGGCUGCUGGAAG GCAGCCGCCGGUCGAGCCCGUG
91 GATCTCATGCGACACAGCCCCGACGTGCCTCGGGAGGCGGTGATGTCACCGACCATGGTCACCATACCTCCTCCCCAGATACCCTTTGTGGGTTCCGCGCGTGAACTC 314 MD1110 Direct 105627 105734 108 123.6 CGACGUGCCUCGGGAGGCGGUG UCACCAUACCUCCUCCCCAGAU
92 TGACGTAGGTGTAGTTTCGTTATTATCGGAAGCCGTTTCGTTTTCCACGGACATGGTTTCGTTGTAATATAAGGAGCTCATGTCA 201 MD1134 Direct 107616 107700 85 131.3 UUUCGUUAUUAUCGGAAGCCGU ACAUGGUUUCGUUGUAAUAUAA
93 CGGTAGCGGGGACGGTGGCATCGGGGAAGAGACGCGTGAGGCGTTCGAGCGAGTGATCGCGTCGCCCGCTACTG 359 MD1165 Direct 109811 109884 74 121.3 AGACGCGUGAGGCGUUCGAGCG GAGCGAGUGAUCGCGUCGCCCG
94 GGCCAGGTGCGTTTTGTGTAGTTTTAGGGCAAAGTCGGCGATCTGTCGTAGTGCCCATTGGGGGATGAGATGTTGCTGATTCTGTTTAGAGAGTATGTAGACCAGGCGTACGAGGCT 108 MD1168 Direct 110085 110201 117 143.6 CAAAGUCGGCGAUCUGUCGUAG UGAGAUGUUGCUGAUUCUGUUU
95 GCATCTGACATCGACCGCTCTTGAGTACATCCACGGCGTAACGGTGAAAGCTGTTACGTAGTAGTGCGCTGAGGTCTAGGTAGTTGAAGTCAAGTGC 213 MD1171 Direct 110456 110552 97 130.2 UAACGGUGAAAGCUGUUACGUA UGUUACGUAGUAGUGCGCUGAG
96 GCTCGTGTTTTTCAGTTTGTCGTAGTATAAAGTTGTCGCGTTGATAGGGCGCTTTGAAAAGTACGCGT 452 MD1175 Direct 110624 110691 68 115.4 UGUUUUUCAGUUUGUCGUAGUA AUAGGGCGCUUUGAAAAGUACG
97 GCTACCCGTCGCCGTCTTCTTCGAGCCGCACGAGGAAAACGTGCTGCGCTGCCCCGAGCGCGTGCTTCGGCGGTTGCTGGAGGACGCGGCGGTGGC 88 MD1195 Direct 112253 112348 96 146.2 UGCUGCGCUGCCCCGAGCGCGU CGCGUGCUUCGGCGGUUGCUGG
98 TGCTGCGCTGCCCCGAGCGCGTGCTTCGGCGGTTGCTGGAGGACGCGGCGGTGGCAATGCGCGGCG 391 MD1196 Direct 112294 112359 66 119.1 UUCGGCGGUUGCUGGAGGACGC AGGACGCGGCGGUGGCAAUGCG
99 GGCGGCGGCGCCGTGCTCATGCAGCTCAGCAAGAGCAACCCCGTGGCCGACTACATGTTCGCGCAGAGCTCCAAACAGTACGGCGATTTACGTCGCT 263 MD1218 Direct 113862 113958 97 126.4 CAACCCCGUGGCCGACUACAUG UGUUCGCGCAGAGCUCCAAACA
100 GGGCTCGTCCCTCTTTAACGTCAACGATATTTACGAACTGTTGTACTTTTTAGTGTTGGGGTTTCTTCCGAGCGTGGCGGTGTTGTAATTTCCACCACGTGTCGCTCGCTGCATAAAGGGCGAACGTCCTCGGAGAGGGTATATTCGTTCGGCGAGAGCGGGCGGCGGTGGTGGGTATGTCCCCTTCTGTGGAGGAGACTACCTCAGTCACCGAGTCCATCATGTTCGCTATCGTGAGTTTCAAACACATGGGCCC 72 MD1221 Direct 114050 114305 256 149.1 CAACGAUAUUUACGAACUGUUG CAUCAUGUUCGCUAUCGUGAGU
101 CGACGTGGAGGCCGCGACGTCGCTTTCGGGCTCGGAAACCACGCCGTTCAAACACGTGGCTTTGTGCAGCGTGGGTCGGCGTCGCGGTACGTTG 28 MD1255 Direct 116916 117009 94 162.1 CACGCCGUUCAAACACGUGGCU CGUGGGUCGGCGUCGCGGUACG
102 CGGCCTATTACCGTCGGCGCGACTCTCCGGGCGGTATGGATGAACCACCGTCCGGATGGGAGCGTTACGACGGTGGTCACCGTGGTC 110 MD1268 Direct 117896 117977 82 142.9 CGUCGGCGCGACUCUCCGGGCG CGUCCGGAUGGGAGCGUUACGA
103 CCGCGGTTATTATCAACGTCTCTGTGTTTTTATTATTTAGAAATAAATACAGGGAATGGGAAAAACACGCGG 435 MD1283 Direct 118693 118764 72 116.2 AUUAUCAACGUCUCUGUGUUUU CAGGGAAUGGGAAAAACACGCG
104 GTCGTGGCGCGGGCACGGACCGCAACGTGCTGCTGATGTCTGCCGCGGTACGCACGTCGCCGTCCATGTCGCTGCGCAGAT 194 MD1285 Direct 118847 118927 81 131.8 GGGCACGGACCGCAACGUGCUG UACGCACGUCGCCGUCCAUGUC
105 ACGTGCTGCTGATGTCTGCCGCGGTACGCACGTCGCCGTCCATGTCGCTGCGCAGATAAGAGGTAGGTCGT 437 MD1286 Direct 118871 118941 71 116.1 AUGUCUGCCGCGGUACGCACGU CAUGUCGCUGCGCAGAUAAGAG
106 GGTACCAAGTCGTCAAGGCTCGCAAAGACGTGCCACGAGGGGATGACGAGCGTGAGAGCCCCGTTGTTACCGCTTCGACGTCTTTGTCCGGTCAGGATCAGTGCC 347 MD1288 Direct 118972 119076 105 121.8 AAAGACGUGCCACGAGGGGAUG UUGUUACCGCUUCGACGUCUUU
107 GGGACAGTCCGGCTTGGGTGTCCGAGTCCTCGTCGCCGCTGGCTTCCTCGAAGCCGGCAAACATGGCTTCGGACAGGGGGGTCGGCGTCGGTGTGGAGGAGAGGTCATCTTCGTCGTCCTCTTCC 137 MD1289 Direct 119078 119202 125 139.3 GUCGCCGCUGGCUUCCUCGAAG CUUCGGACAGGGGGGUCGGCGU
108 CGGCGTTACGGTCAGTCGCACGGCCCAGTGGTGAGCCGTGCGGCGGATGATGGCGCGCG 142 MD1302 Direct 119934 119992 59 138.9 ACGGCCCAGUGGUGAGCCGUGC CGUGCGGCGGAUGAUGGCGCGC
109 GCCTGGCGTCAGGCGTCGTGGGCCAAAGTTGTTGAGGTCCACCAGCAGTCGGTCCTGTTCGCCCACCACGCAGCGGCCCTTGATGTTTAAGTCGGTCAGGT 269 MD1305 Direct 120117 120217 101 126.1 ACCAGCAGUCGGUCCUGUUCGC CCCACCACGCAGCGGCCCUUGA
110 AGCGAGCCGCCTTCCACGTTGGTGATGAGCCGAAGCACCTGGCAGTGCAGGCGACCAAAGCTTCCGCTGGCGGCTTCGGCCTCGCTGATCGCGGCCGCT 442 MD1310 Direct 120325 120423 99 115.9 AGCCGAAGCACCUGGCAGUGCA CCGCUGGCGGCUUCGGCCUCGC
111 GAGACGCGCCTGCCACATCTGCTTGCCCGACGCGTGAATAACAGCGTCGGCTACGGGCAGGTGTCGGTGTTTGCGCTC 215 MD1327 Direct 121859 121936 78 130.0 UGCCACAUCUGCUUGCCCGACG AGCGUCGGCUACGGGCAGGUGU
112 GGTGTTTGCGCTCGGCCGCCGACGGGTAGTGGTGCACGTTGATGCTGGGGATGTTCAGCATCTTGAGCGGCAGCGCGTACACATAGATCGACATGGGCTCTTGGCTGGGGCAGATGCT 192 MD1328 Direct 121924 122041 118 131.9 UAGUGGUGCACGUUGAUGCUGG UGAGCGGCAGCGCGUACACAUA
113 GTCGTATTTTCCGTAAGCTTACAGTCTTGCGGTTCCGTCTCCGGGGACGCCAGTCGCATGGGCAGCAGGTCCTCCAGCGCGATGGAAGCGCCCAGCACCGAGAGCTGCTGTTGCGACGGCGAATGGGACGTGGACCGCGAGTGTAGCGTGGATTTGAC 428 MD1335 Direct 122662 122819 158 116.4 UACAGUCUUGCGGUUCCGUCUC CCAGCACCGAGAGCUGCUGUUG
114 CTGGATCAGATGGTAGGTGCCGCGGTGCACCCGAGGCTGACGGATGTCGTGTTTATCCGTCAGTGTGAGGATGGTCTGCGGTGAGCCGCTGTGCTTGTCCAG 25 MD1352 Direct 124044 124145 102 164.9 GGAUGUCGUGUUUAUCCGUCAG UCCGUCAGUGUGAGGAUGGUCU
115 TCAACGTCAGCGTCATATTGCGCAGCAGGCCGCGCAGTCGTACGTAGCCGCGGGTGTGATCTACGAACTGGTGTAGGCCCAGCTGGTAGTGCTTGATGAGATGTAGA 125 MD1364 Direct 125112 125218 107 140.2 CGCAGCAGGCCGCGCAGUCGUA UACGAACUGGUGUAGGCCCAGC
116 CGGAGGAGAAGCGGAGACGAACAACGTCTGCACCGGGCGCGGCGTCAGAGCGAGCGTGGCGCGTCCGGGCCCGCGTTTGCGTCTAGGTGACTCGCCG 271 MD1368 Direct 125354 125450 97 126.0 ACAACGUCUGCACCGGGCGCGG CGCGUCCGGGCCCGCGUUUGCG
117 CGTGGTGGTGCTGAGGATCGGTAGCGCTTCCTGCGTCAGACGGCACGGGTTTTCGATGAGTTGTTCCGTGCCTTCGACGCAGACGTACTGCGTGTCCGTGTCGCCGCG 187 MD1369 Direct 125616 125723 108 132.8 UCCUGCGUCAGACGGCACGGGU UUCCGUGCCUUCGACGCAGACG
118 TTGTGTGTGGCCGCGAAAGTCTGTGCGTCCGCTTCGCGATGGTCGTAGATGGCCTTGGTGGCGGCCTCCGTGTCGTACGGATCGACGGCCAGCATGCAG 229 MD1372 Direct 125914 126012 99 129.0 UGUGGCCGCGAAAGUCUGUGCG UACGGAUCGACGGCCAGCAUGC
119 GTACGGATCGACGGCCAGCATGCAGGAGGCACGCCCGCGCGGGTTGTTGGGGATCTTAAAGTAATTAACGTCCATCGTCACCGGCGTAAGGATTAGTTCGCACGCGGCCTTTTGTCCGTGC 388 MD1373 Direct 125988 126108 121 119.2 CGCGCGGGUUGUUGGGGAUCUU AACGUCCAUCGUCACCGGCGUA
120 GGACGCCCATGTCGGTTCGCACGCGGTTTACGTAGGCTACGCAGGTATTTGACGTGTAACCCAGACCCATGTCTACGGTGTTAATGTTCTGCGTGACGTGGTACGTGGTGCTGATGTCGCGTTC 261 MD1378 Direct 126278 126401 124 126.5 CCCAUGUCGGUUCGCACGCGGU GGUGUUAAUGUUCUGCGUGACG
121 GGTTCGCACGCGGTTTACGTAGGCTACGCAGGTATTTGACGTGTAACCCAGACCCATGTCTACGGTGTTAATGTTCTGCGTGACGTGGTACGTGGTGCTGATGTCGCGTTCC 35 MD1379 Direct 126291 126402 112 159.1 UAACCCAGACCCAUGUCUACGG GGUGUUAAUGUUCUGCGUGACG
122 GACCCATGTCTACGGTGTTAATGTTCTGCGTGACGTGGTACGTGGTGCTGATGTCGCGTTCCTCCTTGGTCACGATAGGGTT 394 MD1381 Direct 126341 126422 82 118.9 CGUGGUACGUGGUGCUGAUGUC AUGUCGCGUUCCUCCUUGGUCA
123 GCTGTAGAGCAGCATGTCCACCTCGAAGGTGTCGGTGCGTACGGCCGTGAGTGCGAATCCCGGGTGGATGTGCGCCTTGGTCTGCAGC 58 MD1384 Direct 126453 126540 88 152.1 GAGCAGCAUGUCCACCUCGAAG UGCGAAUCCCGGGUGGAUGUGC
124 GCGGGAAACCACCGTCGTGACGGTGATAGTGCGGGAACTCGGTCACGTAGCGTTTAATGTCGTCGCTCAACGCCGCGCAGATGGTGGGGTTTGAGT 443 MD1386 Direct 126680 126775 96 115.8 CGUGACGGUGAUAGUGCGGGAA AACGCCGCGCAGAUGGUGGGGU
125 GGGTAGGCTGTACTCGATCAACGTCTTAGGCGCCGTCACGACGCAGCAGCCGTTGTAAAGCACGTGCTGACGTGAGATAAAGTCCGGCAGGCCC 440 MD1388 Direct 126795 126888 94 115.9 UCACGACGCAGCAGCCGUUGUA GUUGUAAAGCACGUGCUGACGU
126 AGCGGCGTATGTGCGTCGGTGGCGACGTCCTCCACCAGCTCGGTCAGCATCTCGCCTACGGCTTGACGTTGCGCCGCT 285 MD1392 Direct 126988 127065 78 125.0 UCCUCCACCAGCUCGGUCAGCA GCAUCUCGCCUACGGCUUGACG
127 GCCGCTATCGAGTCTTCGGGGGTGACGCCGCTTGTGCTCTCTTTCGACGTCGTACCTGACGTGGAGACCGCGGTGGCGGCCGGCATCAGGAGAAACGCCGGTCGGT 303 MD1394 Direct 127060 127165 106 124.1 ACGCCGCUUGUGCUCUCUUUCG UGGAGACCGCGGUGGCGGCCGG
128 GTTCAACGGTTGCCGGTCGGCCACTACCTGTACGCCTTCCATGTTACGCGGCAGGTGCGTAACGAAGGGGGGCCACAGCCGGTGGTCGTGCAGCGCGTTCAC 15 MD1397 Direct 127383 127484 102 170.7 ACUACCUGUACGCCUUCCAUGU AACGAAGGGGGGCCACAGCCGG
129 GCGGCGCGCCGCACCGCCCATGGGTTCCTGCTGAAAACGACACTCGAGCAGTCGTTGCATGGCGGGTTCCGAGGGTGGTCCGCGTTCCGT 42 MD1408 Direct 128121 128210 90 155.7 AAAACGACACUCGAGCAGUCGU GCAUGGCGGGUUCCGAGGGUGG
130 CTTACCATCACGCCACTGATCTTGGCCCCCGAGCTCGTGGTGTACGTGGTGGG 331 MD1415 Direct 128779 128831 53 122.5 CUGAUCUUGGCCCCCGAGCUCG GAGCUCGUGGUGUACGUGGUGG
131 TCGCGGCGGCGGCGTGAGCGCGAGGCGTCGGAGCTCGGGGAAAGCAGCGCGACCCGGAGAATGGCCGGCGCTGCGCCGCGCCGCCTCGGCTGTGA 109 MD1425 Direct 129602 129696 95 143.3 AGCGCGAGGCGUCGGAGCUCGG CGCUGCGCCGCGCCGCCUCGGC
132 CCCGGCCGCCGATCGCGTTCGACGTTACGTGTGCATCATCTCGCGTCTCATGTACGCTCGGTACGGGGAGAGATGGCGTAAACACCGTCAACGGCGGTCGGAGACGGG 84 MD1444 Direct 131017 131124 108 146.7 GCCGAUCGCGUUCGACGUUACG GGAGAGAUGGCGUAAACACCGU
133 CGTCCGACGCCGGGTTGGCACGACGCGGCGTTGTTAATGGACGACGGTACGGTGCGCGAGCACGCGTTTCGCAACGGACCGTTGTCGCAACTGATTCGCCGTGTGTTACCGCCGCCGCCCGACGCCGAAGACG 9 MD1457 Direct 132532 132664 133 176.0 CGCGAGCACGCGUUUCGCAACG CAACGGACCGUUGUCGCAACUG
134 GTGGCGCGACGGTGATGCGAGTGGTGAGGAGCGCCGGGGAGACGACGACAGCAGGGACGAGCTGTACGACGTGCCGGGCATTTATATGATTCGCGTCAACGACGGCGGC 111 MD1459 Direct 132840 132948 109 142.8 CGCGACGGUGAUGCGAGUGGUG UGUACGACGUGCCGGGCAUUUA
135 GCTGCTCTTGCTCGACGTGCCGCGTCTGGAGAACTATTTTCTTTGTCAAGTCTGTCTTTACGAGTTGGACGAGGACGAGATGGGCGAGGAGATGCTGGGCATGTTGGCCGGAAAGC 75 MD1468 Direct 133293 133408 116 148.6 UUUCUUUGUCAAGUCUGUCUUU GGACGAGGACGAGAUGGGCGAG
136 TGCCGGCGTCAGTCGCCGGCACCTGGTGGCTCTGCTGCGTGCCTAGCTGACCCTGAAACGGATGGCGTGTATATCGTCACACAGGTAGGTGGCCATGATGACGGCG 53 MD1474 Direct 133728 133833 106 152.6 CUGGUGGCUCUGCUGCGUGCCU AUGGCGUGUAUAUCGUCACACA
137 GACACGCCGTGGCGTCGCCCTTCTCCGTGAAGCTGTGCAGGTGCTCTTCGCACACGTAAGAGACCACGTTGAGCATGTCAAAGGGCGCATTGTTGAGGCGCGTC 264 MD1485 Direct 134645 134748 104 126.3 UGCUCUUCGCACACGUAAGAGA AGACCACGUUGAGCAUGUCAAA
138 GCGGCGTGTACAGCTACCTCATGACGCACGCCGGCCGTTACGCCGACGTGATCCAAGAGGTGGTCGAGCGCGACCGC 300 MD1493 Direct 135724 135800 77 124.2 AGCUACCUCAUGACGCACGCCG ACGUGAUCCAAGAGGUGGUCGA
139 TACGGACGAGTGGAAGGGTGCCGGTGTCTCGCGTCTCCGCGAGGTCTGGGATGTGCAGCATCGCGTGCGCCTCCGTGTGCTGTG 131 MD1507 Direct 136923 137006 84 139.6 GUGCCGGUGUCUCGCGUCUCCG UGGGAUGUGCAGCAUCGCGUGC
140 CGCGAGTATCGGGCCGTCGCTTGCCGTTCGACGATCTTTAGTCCGGAGGACGACGGCTCGTGTATCTTGTG 218 MD1517 Direct 137762 137832 71 129.7 AUCGGGCCGUCGCUUGCCGUUC AGGACGACGGCUCGUGUAUCUU
141 GCTTTAGCCAGGTGACCAGCAGTATGACGTGCGATGGTATTACGCCCGACGTGATTTACGAGGTCTGCATGTTGGTGCCCCAGGATGAAGC 170 MD1522 Direct 138018 138108 91 134.6 UAUUACGCCCGACGUGAUUUAC AUUUACGAGGUCUGCAUGUUGG
142 CGCTTGCGGCACAGCGCCGCCACATTGGTGAAGGCCGTGGAGATGCAGGAGGTGGGGTGGCTCTTGCGCTTCTGCAGCTCCGCGTAGCGCTCCTGGATCTTGGCGGCCGAATCTCCGCGCAACATGATGGCGGCGGCGGTGGTGCGAGCG 336 MD1539 Direct 139573 139722 150 122.2 UGCGGCACAGCGCCGCCACAUU UGGCGGCGGCGGUGGUGCGAGC
143 CCTCAACTGCCGTCAGGTCTCCGGGGTCCGCCGGGGTTTCGACGTCCCTGTGCTCGGTGGAACGGATGGTCGAGCTGTCGGCGCAGTCTCCGGCCGCCGATTTCTCGGTCTCCGAGGCTTGGCGCTTCGAGG 117 MD1543 Direct 139937 140068 132 141.2 CCGUCAGGUCUCCGGGGUCCGC CCGAUUUCUCGGUCUCCGAGGC
144 GGTCGAGCTGTCGGCGCAGTCTCCGGCCGCCGATTTCTCGGTCTCCGAGGCTTGGCGCTTCGAGGAGGCCGTAAATATGGCGCTGGTGGCCTGCGAGGCCGTGTCACC 11 MD1547 Direct 140004 140111 108 171.9 CGCCGAUUUCUCGGUCUCCGAG GAGGAGGCCGUAAAUAUGGCGC
145 GGAAAAGAACGGCGGTGGGTCTCGGGCCAAACGCCGTCGTAGACGACGCGCTCCGAAAAACGACGCCGCCACGCCGTCTTTTCT 240 MD1549 Direct 140277 140360 84 127.9 CGCCGUCGUAGACGACGCGCUC CGACGCCGCCACGCCGUCUUUU
146 TCGCGGCTACGAATTCCCTGCGCCAACGCCGCAGGCGACGACGGCGGGTGGTGGTGGTGGTGGTGGTAGTGGTGGCGGCGG 283 MD1561 Direct 140793 140873 81 125.1 UUCCCUGCGCCAACGCCGCAGG UGGUGGUGGUGGUGGUGGUAGU
147 GTGTTACAGGCGGTGCGCGGCCGCTTCTCGGGGCGCGAGGTGCCCGCCTGGCCGGCCTCGTCGCGCACCTGTTTGTTGTGCGC 295 MD1566 Direct 140986 141068 83 124.3 CGCGAGGUGCCCGCCUGGCCGG CCGGCCUCGUCGCGCACCUGUU
148 CAGTGCGTGGCCGCACACCTGTTGGAGCAACGGGCGGCCGTGCAGCAAGAGTTGCAACGCGCCCGACAGCTGCAATCCGGTAACGTGGACGACGCGCTG 260 MD1570 Direct 141471 141569 99 126.6 CCGUGCAGCAAGAGUUGCAACG AACGCGCCCGACAGCUGCAAUC
149 CAGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCGGCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTG 397 MD1575 Direct 142173 142249 77 118.8 CUCGCGGCAGCGCCGCCAGCGG CAGCGGCGACGGUUACCACGGC
150 GTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGGACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGAC 414 MD1578 Direct 142403 142499 97 117.2 UGUGCCGACGUCGUGUGGGCGG GACGUGGAGCUGCGCGCGGAAA
151 GCCGCTGGCGAGCAACAGCAGCCGCCGTCGCTGGTGGGCACGGGCGTGCACCGCGGTCTGCTCACGGCCACGGGCTGCTGTCTGCTGCACAACGTCACGGT 24 MD1583 Direct 142926 143026 101 164.9 ACGGGCGUGCACCGCGGUCUGC UGCUCACGGCCACGGGCUGCUG
152 GCGCGTTTCCCCGTAGCCGGCCTACGGCGTTATTGCATGTCGGAGTTGTCGGCGCTGGGTAACGTGC 384 MD1587 Direct 143409 143475 67 119.4 UUUCCCCGUAGCCGGCCUACGG GAGUUGUCGGCGCUGGGUAACG
153 GTCGCGCAACTCGGTGTGGCATCTGTTGCGTATGGACACGGTCTCGGCCACCAAGTTCTACGAGGCCTTCGTCAGCGGCTGTCTGCCCGGCGCCGCGGCGGCGGACGGTTCGGGTGGCGGCGGCTCGCACTACACGGGCTCGCGCGCCGGCGTCTCGCCGGGCATCCAGTTCGGTATCAAACACGAGGGCTTAGTCAAAACGCTGGTGGAATGTTACGTGATGCACGGACGCGAGCCGGTGCGCGAC 2 MD1603 Direct 144476 144722 247 200.2 CAAGUUCUACGAGGCCUUCGUC AGGGCUUAGUCAAAACGCUGGU
154 GCGAGCCGGTGCGCGACGGCCTCGGTCTGCTCATCGACCCCACGTCGGGGCTGCTGGGCGCTTCCATGGACCTGTGCTTCGGCGTGC 346 MD1606 Direct 144706 144792 87 121.8 UCGACCCCACGUCGGGGCUGCU UGCUGGGCGCUUCCAUGGACCU
155 GTCTTCATCATCGTCGTCCTCTTCTTCGCGGAGGCGACGGCTTTCCAAGCTGTCGTGGTGACTGAGCGCAGCGACTTCTTCGCCGGAGGCTGTGGCCAGCGCCTGGTACTTGACACTGCCGCTACCGCGTCCGCGAAAGTAGCGGACGGCGCGAC 337 MD1626 Direct 146553 146707 155 122.2 UCGUCCUCUUCUUCGCGGAGGC AGGCUGUGGCCAGCGCCUGGUA
156 CGCGCCAGCTACGCTGCGCTGGCCTCGGCCGTGACTACGGACGCCGATGAGCGTCGGCGCGGCCTAGAGCAGCGTAGCGCCGTGTTGGCGCG 43 MD1644 Direct 148044 148135 92 155.4 CGCUGGCCUCGGCCGUGACUAC UCGGCGCGGCCUAGAGCAGCGU
157 GGCCGCACCGGCACTGGGCGTGGAAACCACAGCGCTGTCGAACGCGCTTAGTCTTTTCCACGTAGCCAAGCTAGTGGTC 420 MD1648 Direct 148232 148310 79 116.6 UGGGCGUGGAAACCACAGCGCU UUUCCACGUAGCCAAGCUAGUG
158 GTCTCAATGCCACGGCTTTTCGCGAGCGACCGGCCGGCGGCGATCGTCGCTGGCTGTTGCCGCCGCTGCCGCGTGACGAC 273 MD1660 Direct 148951 149030 80 125.8 CGGCGGCGAUCGUCGCUGGCUG UGGCUGUUGCCGCCGCUGCCGC
159 GGCTTTTCGCGAGCGACCGGCCGGCGGCGATCGTCGCTGGCTGTTGCCGCCGCTGCCGCGTGACGACGGCGACGGTGAAAACAACGTCGTGGAAGTCAGCAGCAGCACCGGCGGTGCGCACCCGCCGAGCGACGACGCTACTTTCACCGTGCACGTTCGCGACGCC 80 MD1661 Direct 148964 149129 166 148.2 GAUCGUCGCUGGCUGUUGCCGC CGCACCCGCCGAGCGACGACGC
160 ACCGCGAGTTTTATGTCTACGACGGCTATTCGGGTCACGGACCCGTCTCGGCCGAAGTGTGCGTGCGGACTGTGGT 371 MD1666 Direct 149386 149461 76 120.4 UUCGGGUCACGGACCCGUCUCG GAAGUGUGCGUGCGGACUGUGG
161 CGCTTGTTGCGCGGGCTGCGTCGTCACTCACCGCCATTCTAGCGGCGGCGGTGGTAGTGGCGTGGGCGACGCGGACCACGCGAGTGGCG 34 MD1669 Direct 149663 149751 89 159.6 UGCGUCGUCACUCACCGCCAUU UAGUGGCGUGGGCGACGCGGAC
162 GCTGCGCGGCCGGTGGCGACTGGCTCTCGGCCGTGGGTCATGTCCTGGGCCGGCTGCCGGC 447 MD1671 Direct 149842 149902 61 115.6 CGCGGCCGGUGGCGACUGGCUC UCAUGUCCUGGGCCGGCUGCCG
163 CCGAGCTGGAAGCCGTGTATCGCGAGATCCTCTTTCGCTTCGTGGCTCGCCGCAACGACGTGGACTTTTGGTTACTGCGCTTCCAGCCCGG 74 MD1675 Direct 149929 150019 91 148.8 UUCGUGGCUCGCCGCAACGACG UUGGUUACUGCGCUUCCAGCCC
164 CGGCGACGGTGTCTCCTCCGTCTTGTTCTTCTTCGTCGGCAACTTGGCTCGAGGAGCGCGACGAGTGGGTGCGCTCGCTG 402 MD1681 Direct 150301 150380 80 118.0 CUUGUUCUUCUUCGUCGGCAAC CGAGGAGCGCGACGAGUGGGUG
165 GCGTGTCTAGTTCGCTTCTCACTCTTCCTCTCCCCGTTCCCAGCGCGGTGGCAGCTTGGGGGGTGAGGGCAAATTGGGGTAGT 135 MD1687 Direct 150597 150679 83 139.3 CGCUUCUCACUCUUCCUCUCCC UGGCAGCUUGGGGGGUGAGGGC
166 AGAGTAGGTAGAGCGCGCTGCAGATCAGCCGCCGGGCGCTGTGGTGCAGCAGCCGGCCGAAGCTTTCGCGCACGTTCACCGCGTCT 431 MD1693 Direct 150893 150978 86 116.2 GCUGCAGAUCAGCCGCCGGGCG UUUCGCGCACGUUCACCGCGUC
167 GCAGGTGGTACAGTTCGGCGTCGCGCGCGCCCAGGCTCATGGAGTCCTCGCGCCGCGAGGCGTAGCGCGTGAGCAGGTCGCGCAGCTCGCGCACGCGATTCTCCCAGGTCTGGTTGAGCGTGCGCAGGTCCTGGATCTCGTCCACCTGC 393 MD1705 Direct 151923 152071 149 119.0 UCGCGCGCGCCCAGGCUCAUGG CGCGCAGCUCGCGCACGCGAUU
168 GCGGATGTGCTTGCCGCGCAGCTGCGCCTCCAGCCGCTCCGAGCGCACCTTCTTGAAGACGCGTACCTCGGGCGCGTTGGCTATGCGCACGGCGCCCAGGCGCTCGGC 282 MD1719 Direct 152605 152712 108 125.1 CUCCAGCCGCUCCGAGCGCACC CGUACCUCGGGCGCGUUGGCUA
169 GCGCGTACCAGGAGCTCTGCGAGCTGGCCGACCCGCTGGGCGACTCGCCGCAGCCCGTCGAGCTCTGGTTCCGCCAGAACTTGGCGCGC 167 MD1745 Direct 154563 154651 89 135.1 CUCUGCGAGCUGGCCGACCCGC UCUGGUUCCGCCAGAACUUGGC
170 AGCTCATGCAGCGTCTCACGGGCGGTCGCTTCGCCACGTTGCCGCTCGTTACCTACAATCGCCGTAACGTGGTGTTCAAGGCCAACTGTCAGATCAGCTCGCAGACCGGCT 405 MD1757 Direct 155490 155600 111 117.8 AUGCAGCGUCUCACGGGCGGUC CGCCGUAACGUGGUGUUCAAGG
171 GCGCGGCCTTTCGCGGCTGGTGCTACGCGATGCGCTCGGGTTCCTCTTTGTGCTCGACGTTAACGTCTCGCGCTTCGTCGAGTCGGCGCAGGGCAAGAGTCTGCACGTGTGCACCACCGTGGACTACGGCCTCACTTCGCGC 183 MD1761 Direct 155722 155863 142 133.2 GGGUUCCUCUUUGUGCUCGACG UCGUCGAGUCGGCGCAGGGCAA
172 GTCATCATTCTGCTTCACATATATGGGTTGTTTGTGTTTTTTTTTTTATAATGAATACGCACTGATCCTATCCGTGACTGCGCGTGTGGC 122 MD1772 Direct 156627 156716 90 140.5 CAUAUAUGGGUUGUUUGUGUUU GAAUACGCACUGAUCCUAUCCG
173 CTATCGTGTCTAAAGTTCACCTATTCTACTATTACTATATATATGCACTACTATGTAACTAGGATATGGTCCTATAAGGTGTCTTCTATCACGGTGG 421 MD1801 Direct 158711 158807 97 116.6 ACCUAUUCUACUAUUACUAUAU AACUAGGAUAUGGUCCUAUAAG
174 ACAAGACAAGAGGCCGCCGGCCGCGGCCACGGACGCGTAGCGGTTACACAATGTTTGGTTGAGCGTTTTGTTTCATCGTCGTGGTGGTGGTTTTGTTGTTCTCTGT 5 MD1804 Direct 158917 159022 106 184.9 ACAAGAGGCCGCCGGCCGCGGC GUGGUGGUUUUGUUGUUCUCUG
175 GAGAAAATCTGTGATTCTCTATGAGTGTTATTTTTATTATCCTTTTGGGGACTACGATTTTTCTT 233 MD1823 Direct 160423 160487 65 128.7 AUCUGUGAUUCUCUAUGAGUGU UUUUGGGGACUACGAUUUUUCU
176 CGACGGTCTTTCTTTTCCGCGTGTCGGGTGACGTAGTTTTCCTCTTGTAGCAACGTGAGGACGACTACTCCGTGTGGCTCGACGGTACGGTGGTCAAAGGCTGTTG 83 MD1828 Direct 161212 161317 106 147.1 UGUCGGGUGACGUAGUUUUCCU GGACGACUACUCCGUGUGGCUC
177 AACGGCACGCGGAAAGGTCTCAGCGAGTTGGACACGTTGTTTAGCCGTCTCGAAGAGTATCTGCACTCGAGAAAGTAGCGTTGCGATTTGCAGTCCGCTCCGATGTCGTT 445 MD1835 Direct 161615 161724 110 115.7 AAGGUCUCAGCGAGUUGGACAC GAGAAAGUAGCGUUGCGAUUUG
178 TTCGTCGCCGTCGTCGACGTCGCCGTCGTCACTTCTTTCGCTCCCTCGACCCAGCAGCGCCCACAGCGCGGGCGAGACGGTGCAGGAGTCCGAGGCGGCGGCGACGGCGGCGGCTGCGGG 63 MD1856 Direct 163147 163266 120 150.3 AGCAGCGCCCACAGCGCGGGCG GCGGGCGAGACGGUGCAGGAGU
179 GGCGCTCTGACAGCCTCCGGATCACATGGTTACTCAGCGTCTGCCAGCCTAAGTGACGGTGAGATCCAGGCTGTCCGTGCACC 101 MD1878 Direct 164507 164589 83 144.1 CUCCGGAUCACAUGGUUACUCA UAAGUGACGGUGAGAUCCAGGC
180 GCCACCGTGTCGCGCAGCAGCACCGTGTCGTGGTCGGGCAAGCTGAGGAAGCGGATCCAGTCGGCGCTCAGACAAAACACGCGAGCCTGCTCGTCGGGGGT 319 MD1886 Direct 164893 164993 101 123.4 UGGUCGGGCAAGCUGAGGAAGC GUCGGCGCUCAGACAAAACACG
181 CGGCCGGTGGTGGCTGGTAAGGTCGATCATGGGCGGCGTGGTGACCGTGGCGGTGGCGGGCATGACGGGGTTTGCGGCGACGGGCACTCCGGCCACAGCGGCGGCAGCGGCGGCCACGGCGGCGCTGGCCGAGCCCACACCTGCCG 235 MD1926 Direct 167393 167538 146 128.5 UGGCUGGUAAGGUCGAUCAUGG CUCCGGCCACAGCGGCGGCAGC
182 CAGTTTCTCACTTACTGAGATTTGTTCCTCAGGTCCTGGATGGCTGCCTCGATGGCCAGGCTCAGGGTGTCCAGGTCTTCGGGAGGGGTCTCGGTGGGCTTCTCAAACTG 173 MD1967 Direct 170678 170787 110 134.4 UGAGAUUUGUUCCUCAGGUCCU CCAGGUCUUCGGGAGGGGUCUC
183 TATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCGGTCATATTGGACATGAGCCAATATA 158 MD2020 Direct 175582 175681 100 136.6 UAAUGACCCCGUAAUUGAUUAC AUAAUCAAUGUCAACAUGGCGG
184 GGCGGTCATATTGGACATGAGCCAATATAAATGTACATATTATGATATAGATACAACGTATGCAATGGCCATTAGCCAATATTGATTTATGCTATATAACCAATGACTAATATGGCTAATGGCCAATATTGATTCAATGTATATATATCGATATGCATTGGCCATGTGCCAACTTGGTATCGCC 298 MD2022 Direct 175653 175836 184 124.2 UGGCCAUUAGCCAAUAUUGAUU CUAAUAUGGCUAAUGGCCAAUA
185 CCGGGCGTGTGGCGCCAGCGAACCGGCGGCGTTGAACGTGGTCCTTTTGTTGGTGCCGCCGCGACGG 97 MD2041 Direct 177685 177751 67 144.7 UGUGGCGCCAGCGAACCGGCGG GGUCCUUUUGUUGGUGCCGCCG
186 TAGTCTTGCTCTTCGCGAACGATCTCGTCCGGTTCCTCGCAATCTTCGTGGTCCACAGAAGATGAGGAGCAGGAATTTTCGTTAATCTCTGCGAGGATACTA 398 MD2078 Direct 180224 180325 102 118.8 CGUGGUCCACAGAAGAUGAGGA AAGAUGAGGAGCAGGAAUUUUC
187 GACGTTTTGTGAGCTAGGTAACAGCTGTGATTTCACCTGTCGCCAAGACTGACAGCGATTACCCAGGTGGAGCACAATCACATAGCTGATAGACGTT 277 MD2105 Direct 183114 183210 97 125.3 UGUGAUUUCACCUGUCGCCAAG UUACCCAGGUGGAGCACAAUCA
188 GGCGCCTATTGTAGCTGTAGCGCCCATAGGTATGGCATATACCCACGGTGATGTTGTGTTATTCGTTTTTTGTGATAAAACGTAGCTTATGTTTAGTGTGTGTTCCGTCACGTTATGTGTGTCGTTAAAAGACGGCGTC 307 MD2111 Direct 183472 183610 139 124.0 CAUAGGUAUGGCAUAUACCCAC AACGUAGCUUAUGUUUAGUGUG
189 CGTTAAAAGACGGCGTCTGTACAGTATGGCTTTGAGTTGTATCTTTAATTGTTATTGCATTTGGAGGTGTTGTGTACAGAGTTGTTATTGCG 287 MD2113 Direct 183594 183685 92 124.8 GUCUGUACAGUAUGGCUUUGAG UUGGAGGUGUUGUGUACAGAGU
190 TTGTTATTGCATTTGGAGGTGTTGTGTACAGAGTTGTTATTGCGTGTTCAGGTGTTACGTTTTGAGGTACAGCTGTGGTGTACACGGGCTCCAAGGTGTAGTTACGG 155 MD2115 Direct 183642 183748 107 136.9 UUGUGUACAGAGUUGUUAUUGC ACGGGCUCCAAGGUGUAGUUAC
191 TGTCGGCCGGCGGTGCTGGCGTCACCGGTAAAAATTTCGGCGGGTGTGGCTGCGAACGGTAGCAGTCGCCGGGGAGCCGGTAACGCTGTATCACTGTCCAACA 30 MD2128 Direct 184611 184713 103 162.0 UGUGGCUGCGAACGGUAGCAGU UAACGCUGUAUCACUGUCCAAC
192 CGTGTCTACGAACGTCATTGTGAAAGTGACGTCTCAGGCTTTCCGAAACCGCGTCAAGTTCAACGTTGGTTTCGGTTTAGCCTGCGTCACCGAGGCGGAGGTGGAAATG 197 MD2155 Direct 186376 186484 109 131.6 CGUCUCAGGCUUUCCGAAACCG UUGGUUUCGGUUUAGCCUGCGU
193 GCGGCGCGGGTATCGGCGTCGGGGGCCTGTGCGACGACAGCCGCGTGGTGGGGGCCCGGACCGGCGGCGTAGGCGGCCGC 342 MD2186 Direct 189193 189272 80 122.1 AUCGGCGUCGGGGGCCUGUGCG UGGGGGCCCGGACCGGCGGCGU
194 GGCGGGGGGAGACGCGTCGGGCGGACCGCCGGGCATCGCCGTCGGCTGCGACGGTGGTTGTGAACTCACCGTCGGCTCGCACGGAGGTTTGTTCTTCGGTCTACCCTTCGGTTTGTCTTTCGCCC 236 MD2192 Direct 190054 190177 124 128.1 GACGGUGGUUGUGAACUCACCG UCACCGUCGGCUCGCACGGAGG
195 TGTCGGTGTTGGCGGTTGCGGTGGGATGACGGGCTGGTGGGACTCCTCCGACGGCGGGGGGACGAACACCGTCGGCGCCGAAACCGGGGGACTCTCGACTATCTCGCAGATCACCCTGTCAGGATCGTCG 166 MD2193 Direct 190204 190333 130 135.1 ACGGGCUGGUGGGACUCCUCCG CGGCGCCGAAACCGGGGGACUC
196 TCGGCCGGCGGTTCGGCGTCCTCCACCAGCGGCGTCGTCTCATCTTTGCCACAGCAGCGGACGCACACCTTCTCCAGGCAGAACGCCACCAGCTGCCGCCGA 324 MD2201 Direct 190855 190956 102 123.3 CGGCGUCCUCCACCAGCGGCGU CAGAACGCCACCAGCUGCCGCC
197 GGTGCAGAATGCGACTCGCGGCGTAGCTCGCCGTCGCTATGCGGCTCGTCGCCGTGTGGCGCGGCCTGGCCGGCTGTCTGCGCC 228 MD2223 Direct 192813 192896 84 129.0 UAUGCGGCUCGUCGCCGUGUGG UGUGGCGCGGCCUGGCCGGCUG
198 TGCCGCGTTGGGCGTGGCAGGGCTGGAAGAGGTGGCGCAACAGCGAGTCTGGGCGTCGATGGAGTGCTGGGTCTGCGTCGGCTTCCAGCTTGTCTGACTTGGCGGGCG 126 MD2237 Direct 193792 193899 108 140.0 AAGAGGUGGCGCAACAGCGAGU GAGUGCUGGGUCUGCGUCGGCU
199 GCGTCGATGGAGTGCTGGGTCTGCGTCGGCTTCCAGCTTGTCTGACTTGGCGGGCGAGGCCGTTGGAGAATTGGTGGGATCGGTCGTCGC 29 MD2239 Direct 193844 193933 90 162.0 GGUCUGCGUCGGCUUCCAGCUU CGGGCGAGGCCGUUGGAGAAUU
200 GGGTGTGTCAGGGGTGTGTCGGGGTGTGTTGGCGGGCCGTGTCTGCGTGTGTCCTCGACGCGGGTTGTGCAGTGTGCCCCGGGGCCCGCGACTCCTCCC 68 MD2252 Direct 195307 195405 99 150.0 UCGGGGUGUGUUGGCGGGCCGU GUUGUGCAGUGUGCCCCGGGGC
201 GCTGATCCTAGCGGCGCGCGACGCGGACGAGTGGTTTCGGCACGGCGCGGGCGAGGTGGTGCGGCTGTACCGCTGCAACCGGCTGGGCGTGGGCACCCCGCGCGCGACGCTGCTGCCTCAGC 69 MD2269 Direct 196650 196771 122 149.6 CGCGCGACGCGGACGAGUGGUU CCCCGCGCGCGACGCUGCUGCC
202 CAGCCGATGGTGCTGCTGGGCGCGTGGCAGGAGCTGGCGCAGTACGAGCCGTTCGCGTCGGCGCCGCACCCCGCGTCGCTGCTGACGGCCGTGCGTCGGCACCTGAACCAGCGTCTGTGCTGCGGCTG 20 MD2274 Direct 196885 197012 128 169.0 UGGGCGCGUGGCAGGAGCUGGC CUGCUGACGGCCGUGCGUCGGC
203 CGGCAGCGGCAGCAGCGGCGGCGCCGACGGTGATGGTGGGTCCGACGGCGATGGCGGGTCCGGCGGCGTCGGGGACCGTGCCGCGCGCCATGCTGGTGGTGGTGCTG 146 MD2277 Direct 197267 197373 107 138.2 ACGGUGAUGGUGGGUCCGACGG UCGGGGACCGUGCCGCGCGCCA
204 GCGGGTCCGGCGGCGTCGGGGACCGTGCCGCGCGCCATGCTGGTGGTGGTGCTGGACGAGCTGGGCGCCGT 365 MD2279 Direct 197320 197390 71 121.0 UGCCGCGCGCCAUGCUGGUGGU UGGUGGUGCUGGACGAGCUGGG
205 GTGCCGCGCGCCATGCTGGTGGTGGTGCTGGACGAGCTGGGCGCCGTGTTCGGGTACTGCCCGCTGGACGGGCACGTGTACCCGCTGGCGGCGGAGCTGTCGCACTTTCTGCGCGCGGGCGTGCTGGGCGCGCTGGCGC 258 MD2280 Direct 197344 197482 139 126.6 CUGCCCGCUGGACGGGCACGUG CGGGCGUGCUGGGCGCGCUGGC
206 GGCGGCGGAGCTGTCGCACTTTCTGCGCGCGGGCGTGCTGGGCGCGCTGGCGCTGGGGCGCGAGTCGGCGCCCGCCGCC 181 MD2282 Direct 197430 197508 79 133.4 GGGCGUGCUGGGCGCGCUGGCG UGGCGCUGGGGCGCGAGUCGGC
207 GGCGGAGCTGTCGCACTTTCTGCGCGCGGGCGTGCTGGGCGCGCTGGCGCTGGGGCGCGAGTCGGCGCCCGCCGCCGAGGCCGCGCGGCGGCTGCTGCC 85 MD2283 Direct 197433 197531 99 146.5 GCGCGGGCGUGCUGGGCGCGCU AGUCGGCGCCCGCCGCCGAGGC
208 GCGGCTGCTGCCCGAGCTGGACCGCGAGCAGTGGGAGCGGCCGCGCTGGGACGCGCTGCACCTGCACCCGCGCGCCGCGCTGTGGGCGCGCGAGCCGC 59 MD2286 Direct 197520 197617 98 151.8 GGCCGCGCUGGGACGCGCUGCA CGCUGCACCUGCACCCGCGCGC
209 CTGCTGCCCGAGCTGGACCGCGAGCAGTGGGAGCGGCCGCGCTGGGACGCGCTGCACCTGCACCCGCGCGCCGCGCTGTGGGCGCGCGAGCCGCACGGGCAGTGG 114 MD2287 Direct 197524 197628 105 142.1 UGGGAGCGGCCGCGCUGGGACG CACCCGCGCGCCGCGCUGUGGG
210 GGGGACCCGGGTGTCGCGACATGTCGACGACAGGTGCGGATTAGTGGTCGTGTCGCGACATGGACGTGCAGGGGGATGTCTGTCGCGATAGAGTTGATGTGACAGCCCGCTACACCTCTCTGTCGCGACATGCATACACAACGGGCCGGCTTGTCGGCGATTGTCGCGACATATCGTTATC 31 MD2320 Direct 201316 201496 181 161.3 CGCGACAUGUCGACGACAGGUG GGCUUGUCGGCGAUUGUCGCGA
211 TGTATGATGTAACGTGTGACGTGAGTCTGATCCAACACTGAACGCTTTCGTCGTGTTTTTCATGCAGCTTTTACGGACCATGACAAGCCTGACGAGAGCGTTCATCGGGGCATGAAGTACGCATTACACAAACTCCATATATTTGTTAC 91 MD2326 Direct 202237 202377 141 145.9 GCUUUCGUCGUGUUUUUCAUGC AUGACAAGCCUGACGAGAGCGU
212 GGAACGGAGGAGGCTTTCGCCACACCTATCCTGAAAGCGTTGCATTCTTTATGATAGGTGTGACGATGTCTTTACCATTCC 455 MD2327 Direct 202396 202476 81 115.3 CACCUAUCCUGAAAGCGUUGCA UUUAUGAUAGGUGUGACGAUGU
213 GACCTCTGATGCGATGTGAGGATTAAATTGTCCCTCAAACCGCCAAACGCTGGTCATGTTTCCACCGTCAATTACGCAGCTGACGGTGTGAGATACCACGATGTTGGACTTAGGTTTGGGGGCTAATTGCCTTTTTACAAATTCCCTTCTGTATTGCAGGTC 87 MD2338 Direct 203003 203164 162 146.2 AACGCUGGUCAUGUUUCCACCG ACGGUGUGAGAUACCACGAUGU
214 GTTTGGCATTGATGACAGGGGGAAAAGTAGAACAACACGAGTTTTGTGCGTTGGGGAACACGATAGTCCCGGAGCCAGTAGCGTTTTGCGACGAGGCTTTCGGAGATGTCCTCCACCGGCGTCGGCACTCGATCCGCGTAGCCCTCCAGCGTCTGGTAGTAC 400 MD2369 Direct 206167 206328 162 118.5 ACACGAGUUUUGUGCGUUGGGG CGAGGCUUUCGGAGAUGUCCUC
215 CGACGGTGCCGTAGAGACGTACCATCCAGAGAAAGTGTTGAACGCTCCGCAGGGTGTCTTCATCTTTGGTGATTACGGTGACTCGACGGATCGGCG 424 MD2389 Direct 207430 207525 96 116.6 ACGCUCCGCAGGGUGUCUUCAU AGGGUGUCUUCAUCUUUGGUGA
216 CCTTGGTGAAACTGGATCTGTACCATGACGGGTGCTCGACGAACAGTCGTCGGGGCTTCAGGTACCCGGCAAGTTTTATAGAGAAAGG 439 MD2391 Direct 207582 207669 88 116.0 GACGAACAGUCGUCGGGGCUUC GGGGCUUCAGGUACCCGGCAAG
217 GACGTAGCCAACACACCGCATCTTCGGAAGCTGTGGACGCTGTTTCCGAATACCGGGAGGAGATCGTGCTTCCCTCTTCCAAGGATCGGAAAGTAGCGTCCGTCGTTTCCGCGGACGCGGCTTCCCTGGTACGCTC 16 MD2411 Direct 209293 209428 136 170.5 GCUGUUUCCGAAUACCGGGAGG UAGCGUCCGUCGUUUCCGCGGA
218 GGTACGCTCCGTTTCCGACGACGCGGTTTCCCGCTGCGTGGAAACTGTCTCCATGTCGGGACCGCAGCGCC 334 MD2412 Direct 209420 209490 71 122.4 CGUUUCCGACGACGCGGUUUCC AACUGUCUCCAUGUCGGGACCG
219 TCCGCAAAAGCCCGTGCACACGGTGATGCCGGTGTTGATCAGCAAGCACGCCACTGTGAGATGAGCAAAATTGGTGGTGTGTGGGCGAAACTCGGCGAAACCGCGTAGCATAGCCAGCGTGGA 211 MD2451 Direct 213024 213146 123 130.4 CCGUGCACACGGUGAUGCCGGU GUGGUGUGUGGGCGAAACUCGG
220 TCGTCCCGTCCCCGCTCGCATAGCTCGGCCACCGGTGGCGGCATGAGCCACCAGCTGAGCACGCTGAGGGCGACGGTGGCGG 441 MD2462 Direct 214086 214167 82 115.9 UGGCGGCAUGAGCCACCAGCUG CAGCUGAGCACGCUGAGGGCGA
221 ATGGCGACAAGCGCGGCTGCTGTGAAAACGGGCGCGGTTTTATAGGCATTAGGACTTCCCCGTCGTACTGGCGGCTGTCAAAGTCCCGT 326 MD2463 Direct 214272 214360 89 123.1 UGCUGUGAAAACGGGCGCGGUU GGACUUCCCCGUCGUACUGGCG
222 CTGGTCGGGTTCGGGGATGGGGACCTGTTTCAGCGTGTGTCCGCGGGCGTGCATGGCTTTTGCTCGCCGGCCGCGCTGTAACCAGGCCTCTTTCTCTGTGGTCGGCGAG 36 MD2484 Direct 216132 216240 109 158.7 UUUCAGCGUGUGUCCGCGGGCG GCUCGCCGGCCGCGCUGUAACC
223 CCTCGGTGCGACCCGGCGTGCGGATGACCAGGTTGAGACCGTTCATTTCGCGGGCCGTCTTGGCCACGGCCGCAGCGTCAGTGGGGTCGGTGCAGAGG 313 MD2495 Direct 217139 217236 98 123.7 GACCGUUCAUUUCGCGGGCCGU CGUCUUGGCCACGGCCGCAGCG
224 CGTCTTGGCCACGGCCGCAGCGTCAGTGGGGTCGGTGCAGAGGAATTTTTGCACATGATAGCGCGGTTCGGTGGTGGCGAACGGCG 79 MD2497 Direct 217194 217279 86 148.2 UGCAGAGGAAUUUUUGCACAUG CACAUGAUAGCGCGGUUCGGUG
225 TCTTGGAAAAGGCTTTGATATCACTGGCCACCTCGTAGAGCCCGTCGGTCTCCCAGTCGTAGACGTAGACGGTGCCGTAATGACTTAGCATGAGCACGCAGGGCAGTTCCTGCGCCTGCTTGGTGTTTCGTGTTAGATCGCTGTCGGGTGGACGTACGGCTAGTACACCGACGGCTTCCAGGGTGTCATCGCAGCAGAGAT 64 MD2499 Direct 217322 217521 200 150.2 CCGUCGGUCUCCCAGUCGUAGA ACACCGACGGCUUCCAGGGUGU
226 GTAGTCGCGGTCTACGCCGCTGTCGAACATGGTAAAGTGAAGACGCGCCGCCTCGCCCATGTGTACGCAGCCTCCGTTGCGTTCCAGCCTGGCCGCGCGCCGCAGACCGTGTTCGTAGCGGCGACGCACGTAC 352 MD2516 Direct 218636 218768 133 121.6 UACGCAGCCUCCGUUGCGUUCC GUUCGUAGCGGCGACGCACGUA
227 GTCGTCCAGCAGTTGGTCGCGCAGCTCCGGCATGGTGCTGCCGGGCCGCACCTGCAGGAACCAGTTGTGCGGAATGCCGAGCGAC 429 MD2524 Direct 219455 219539 85 116.3 UGGUCGCGCAGCUCCGGCAUGG ACCUGCAGGAACCAGUUGUGCG
228 GCTTGTGGTCTACGGCACGCTCGTGGTGGTGCGGGCACAGATGACGGTGTTCCATACGCGTCTGACGTTGACGCTCGCGCTCAAAACGCCGGTGTCGAAAGACCATTTTCAGC 210 MD2534 Direct 220233 220345 113 130.7 AUGACGGUGUUCCAUACGCGUC ACGCUCGCGCUCAAAACGCCGG
229 GCCTCGGTCTGAGAACCGACCTAGCGTTCGGACCGGTGCGCAGAAACAGCCGGCGGTCCGAGCCACTGAGCGGTTCACAGCCCCGGC 78 MD2545 Direct 221465 221551 87 148.3 CGACCUAGCGUUCGGACCGGUG CGGUCCGAGCCACUGAGCGGUU
230 GCAGCATAAGCGGTCCACAAAGAACTTCAACAGGTCGTTGAATTGCTCCGTCTCCATACAGATGAAGGGCCAGACGCCTTTGAGGTTCTCGGCCTGGCCGCAGAGCAGC 423 MD2567 Direct 222961 223069 109 116.6 AUAAGCGGUCCACAAAGAACUU AAGGGCCAGACGCCUUUGAGGU
231 AGACGCGTAGCGATAGGACTGGCGCATGGTGCCGCGGCGTGGAGCGGCACTTGGCAGCCTATTTTATGGAGTTT 385 MD2579 Direct 223741 223814 74 119.4 UAGCGAUAGGACUGGCGCAUGG CUUGGCAGCCUAUUUUAUGGAG
232 TGCGGTGTTTCCGATGGTGGCTCTACAGTGGGTGGTGGTGGCTCACGTTTGGATGTGCTCGGACCGTGACGGTGGGTTTCGTCGCGCCCACGGTCCGGGCACAATCAACCGTGGTCCGCTCTGAGCCGGCTCCGCCGTCGGAAACCCGACG 7 MD2615 Direct 226663 226813 151 180.5 GGAUGUGCUCGGACCGUGACGG CGCCCACGGUCCGGGCACAAUC
233 GCCTACTACGGGGGTTGTTGTATGGTGGGCGGGGGTAATCGTGCGTACGTGATACTCGTGAGCGGTTACGGGACCGCCAGCTACGGCAACGCTTTACGCGTGGATTTTGGGC 227 MD2620 Direct 227088 227199 112 129.0 UGGGCGGGGGUAAUCGUGCGUA CCAGCUACGGCAACGCUUUACG
234 TATCATCTGGTGGACCGGCATCGTGCTTCTGGCGGCGGACGCTCTCGGACTTGGCGAGCGTTGGCTGAGGTTGGCACTGTCCCACCGGGATA 202 MD2640 Direct 228546 228637 92 131.3 CGUGCUUCUGGCGGCGGACGCU CGUUGGCUGAGGUUGGCACUGU
235 GTCCTTGGTCTGCTCGTCTGGATTGCCGCTCGTGCTGTCAGCCGCGTTGGTCCGCATGGCTCCGGACTCGTTTATCGTGAGCTTCATGATTTCTACGGGTATCTGCAGCTGGACCTTCTGGGACCAGTGGTGGCGGGGAATCGCTCAGTCCGGACCTGGAGAGAGCAGGCGGAC 330 MD2663 Direct 230740 230913 174 122.6 CGCAUGGCUCCGGACUCGUUUA GACCUUCUGGGACCAGUGGUGG
236 TGCGTGTCCTGGTTTTTCATTTTTTGGATGTATTTGTCGCATAAAAGGCGGTGGGATGTGGGGATGAAATATATCCAGATACGCA 207 MD2676 Direct 231532 231616 85 130.9 UCAUUUUUUGGAUGUAUUUGUC UGGGAUGUGGGGAUGAAAUAUA
237 GACGCAACAACGACGGGGGGGGGGGGGGCGTACGATTAATTCTACATATTACAGTACAGGCTACCGCGTGGTGTTGTGTATGTTACGATGCGGTGTGCCTGTCGGTGTAATTGGATGTATGTTACTTATCCGTGGCGTTGTGATAGTGTT 76 MD2690 Direct 232190 232339 150 148.4 CAUAUUACAGUACAGGCUACCG CGAUGCGGUGUGCCUGUCGGUG
238 GGTGCCGACGCACGGCCGTCAGCAGCGACGCGGGGTGCGGCGCCGACGCGAACGGCTCGTACTGCGCCAGCTCCTGCCACGCGCCCAGCAGCACC 339 MD2706 Direct 233748 233842 95 122.1 UCAGCAGCGACGCGGGGUGCGG GCUCGUACUGCGCCAGCUCCUG
239 GCTCCCGTCCGAGCGCCGTCGCCTCCTCGGCGCGCAGCAACGTCTGTCGGAGCGCCGGCTGAGGCAGCAGCGTCGCGCGCGGGGTGC 409 MD2707 Direct 233907 233993 87 117.4 CGCCUCCUCGGCGCGCAGCAAC GAGCGCCGGCUGAGGCAGCAGC
240 CCCGGAGGAACACGCGCAACAGGGCCGCGGACTGGGTCCCCGAGCGCGCACCCTCCTAGGTGGACGCCCGACATCCATTCCGGGCCGTGTGCTGGGTCCCCGAGG 366 MD2727 Direct 234994 235098 105 121.0 CGGACUGGGUCCCCGAGCGCGC UGGACGCCCGACAUCCAUUCCG
241 GGGTGTGTCAGGGGTGTGTCGGGGTGTGTTGGCGGGCCGTGTCTGCGTGTGTCCTCGACGCGGGTTGTGCAGTGTGCCCCGGGGCCCGCGACTCCTCCC 67 MR1 Reverse 263 361 99 150.0 UCGGGGUGUGUUGGCGGGCCGU GUUGUGCAGUGUGCCCCGGGGC
242 CCCGTCTCCCTCTGTGGTCGTGGGTGGTGCGAGAGTACACGATGGGTGGCTCTCGTCTCGGGGGACCACAGGGGGAGGGGGG 123 MR67 Reverse 7511 7592 82 140.5 GUACACGAUGGGUGGCUCUCGU UCUCGUCUCGGGGGACCACAGG
243 ACGTTAAAGCAAATTGTATCTCCTTCGGCTACTGTGATGGGTATTTGTACATGTTCACTTTGCAGCAAGAGCTGCTGGTAGGATGTTTTTTGTTTATGT 318 MR121 Reverse 12260 12358 99 123.4 UAUCUCCUUCGGCUACUGUGAU CUGGUAGGAUGUUUUUUGUUUA
244 CGTTAACGTAAGTTAAAACGCAGATAATTATCACCACGGTGGCTGTCCAACCAACGTGAGTGGCTACGTGGGAATTGGTGCGTTTAGAATAACGTGAAGACG 401 MR130 Reverse 12670 12771 102 118.1 AGAUAAUUAUCACCACGGUGGC AGUGGCUACGUGGGAAUUGGUG
245 CCACGGAACGAGTTCTTCCTCTCGCGACAACAGCATCGATCGGTCAGGAGGAGGCGCGATCGCCAGGGACGGTGTACGGGTGCTCACGCTGGAGGTGAATGCTGCTTCGTCCCTTGATATAGCCTTGTTACTCTCCGCCTCGGTGATGTCGTAACAGCAGGACTCGAACGCGG 243 MR149 Reverse 14479 14651 173 127.8 CCAGGGACGGUGUACGGGUGCU AAUGCUGCUUCGUCCCUUGAUA
246 CATTGTATGTGAAGTGGCAGTGTCGTGTTGTGCTTCAACGTTACCGGCGGCGTAGTGGACCGCGGTATGTGTGAAGTTGGTTGAGGTGAATGACTGTGATATTTCTAATG 220 MR180 Reverse 17419 17528 110 129.4 UGCUUCAACGUUACCGGCGGCG GCGGUAUGUGUGAAGUUGGUUG
247 TTTTCTGGTCGTAGTTCTAGAAATCAGCGATAATGTAAAACATGTGGGAAACTCACAGTTACCCTTTGGTGGACATTTTCGCCTGCAATAGTTTCTGGGATCTGAGACGTTTACATGAAGA 363 MR192 Reverse 18102 18222 121 121.0 UCUAGAAAUCAGCGAUAAUGUA CCCUUUGGUGGACAUUUUCGCC
248 GCGGCGGTCGGTCCAGGTCAACGGCGTTTCGCCGTGTCATAACCGACGCCGCTCTGACTTGGAATCCGGCGTGCTGC 328 MR220 Reverse 19846 19922 77 122.7 UCGGUCCAGGUCAACGGCGUUU CGACGCCGCUCUGACUUGGAAU
249 GTGGATCCGGAGGGGGGAACGAGGGTCTCGGAATCGCATTACGCGACTGATTTCGCCGCCGTTGTTCTTCCACCAGATACTGC 251 MR223 Reverse 20062 20144 83 127.0 AGGGGGGAACGAGGGUCUCGGA UGAUUUCGCCGCCGUUGUUCUU
250 CGTGGTCTCGGTCGCCAGGCTGTGGGTCTCGTTGCCCAGCACGCAGGTGTAGGTGCCCGCGGTCTCGGTGATGAGACGAAACG 316 MR242 Reverse 21608 21690 83 123.6 AGCACGCAGGUGUAGGUGCCCG UAGGUGCCCGCGGUCUCGGUGA
251 GGCTTCTCCCGCGGCAGTTTCCTCCGCCGCCTCGTTTTCCTCTTCGGTGTTCAGACGCCGGTACGATTCGGAACACCAGTAGCACAGCAGGTGGCAGAGGGAGGTCAGGGCCACC 279 MR253 Reverse 22047 22161 115 125.2 CGCGGCAGUUUCCUCCGCCGCC GGAACACCAGUAGCACAGCAGG
252 CCGCGTCTGGTACCGCTACTGTGGGCGATGGGACCGACGTCGGAGTCGCGGCGTTCGTTGGCGCCGCTGCCGCGTCGGGTACCGCTGCCGCAGATGAGCGCACCGACGGCGG 343 MR255 Reverse 22298 22409 112 122.0 CUGUGGGCGAUGGGACCGACGU CUGCCGCGUCGGGUACCGCUGC
253 ACAGGGACGGTTCGCATTTTCAGTCCGTCTTGCAAGATGTTAGTGGTGATGTCGCTGAAATTGCGGATCACCGTGT 55 MR261 Reverse 23040 23115 76 152.4 ACGGUUCGCAUUUUCAGUCCGU UCGCUGAAAUUGCGGAUCACCG
254 CGTACCGTTCTCGCAGCGTAAACAGTCATAGCGGCCCACGGTAAGATTAGTGACCATGCGGCTGGTGTACAGTTTAGTCACAGGGACGGTTCG 95 MR262 Reverse 23102 23194 93 144.8 ACAGUCAUAGCGGCCCACGGUA CAUGCGGCUGGUGUACAGUUUA
255 GCGTTGCTGGTCATGACGACCGGACCTTGCGATAGCGCCACGCAAAGGCCAGGTTACGTAGGTATTGTTTCAAGGTGGTAAAGTAGTGCAGGAACGC 182 MR287 Reverse 24997 25093 97 133.4 CGGACCUUGCGAUAGCGCCACG ACGUAGGUAUUGUUUCAAGGUG
256 GTGAGAAGCGGGCGCGGGTTTCAACACGAAACCGCGTCACTCACGGACGTAGGTTATTTCGAAAACCTACGTTAATCCTGAACGCGTTTCGTGTCACGCGTCCCTGCGACTCAC 174 MR290 Reverse 25356 25469 114 134.4 UAGGUUAUUUCGAAAACCUACG CUACGUUAAUCCUGAACGCGUU
257 CCGCAACTTCCTCTTTTCGCAGGTTGAATGAGGAACCCGCGTGGATCCGCAACGCCGGTTTCATCATAAACCGCCGTGAGAAGCGGGCGCGG 54 MR292 Reverse 25453 25544 92 152.5 UUCGCAGGUUGAAUGAGGAACC CGGUUUCAUCAUAAACCGCCGU
258 CCCGGAGTAATCTTCATCTCCGTCGGTGGTGGACCCCCCCTGACTGAGAGTTACGTTCTTGCTGGGGGTGGTATTACCATCGGAGTTAGTGCTGGTACTGGG 320 MR324 Reverse 27628 27729 102 123.4 CAUCUCCGUCGGUGGUGGACCC UUGCUGGGGGUGGUAUUACCAU
259 TCGCTTAGAGCGCTGGCCGGCTGCATGCACATCCACGCGTTCGCGCAGTGGCGTGCTACGTATCGCGGCCGACTCATGGTCATGGGTGA 231 MR336 Reverse 28542 28630 89 128.8 ACAUCCACGCGUUCGCGCAGUG UGGCGUGCUACGUAUCGCGGCC
260 CTAGCCTGGCGCTCACGGCCGAGTTCGGCCTGGGCTGTCTGGAAGCTTACGTGCGCATCAACGCAGGCCAGGTGTTGCCCGTGGTCTGGCCGCCGGGCTGG 222 MR355 Reverse 30067 30167 101 129.3 GAGUUCGGCCUGGGCUGUCUGG ACGCAGGCCAGGUGUUGCCCGU
261 GCGTGGTGTGCGACGGGCCCCCGGGCTCGCCCACTGACTCGGCGCGTCACATGAGCGATCTGGCTAGCCTGGCGCTCACGGCCGAGTTCGGCCTGGGCTGTCTGGAAGCTTACGTGCGCATCAACGC 148 MR356 Reverse 30104 30230 127 138.0 CCCCGGGCUCGCCCACUGACUC CGCUCACGGCCGAGUUCGGCCU
262 GCGCACGAGCTCGAAGGACGACGGAGCGTCCGAGGAGACGCTGTAGGGCGACAAACCGGCCTCCATGCGATCCAGATCTTCCGTGGCGCTGCGCGCCCGCGTGCTCGTGAAAACGC 361 MR360 Reverse 30511 30626 116 121.1 GAGCGUCCGAGGAGACGCUGUA UCCAUGCGAUCCAGAUCUUCCG
263 CGCACGGTGGTCCGTATGGCCTCCACCATGTGGCGCGCTTTCTTTTGCGCCACGTAGTAATAGTTGATGATCACCGCGTG 81 MR369 Reverse 31191 31270 80 148.0 UGGCGCGCUUUCUUUUGCGCCA CACGUAGUAAUAGUUGAUGAUC
264 GGCGGTATAGAAGAGCACGTTGTAATCGCGTAGCGTCTGGTAGACCTCGGTGAGCCGCGGCGATTCGGGCGTGCCGCGATGCCGCAGCTCTTCGTCCAGCCGCC 225 MR370 Reverse 31402 31505 104 129.1 AGCACGUUGUAAUCGCGUAGCG UGCCGCGAUGCCGCAGCUCUUC
265 ACAACGCCGGCGTGCTCGCGTAGAGCGCGTAGTCGTAGTTTTGACTGACGGCCCAGTAGATCACGTCACTAAGCTGCGCGTAGTCTTCGCGCAACGACGGCAGTTGT 147 MR372 Reverse 31754 31860 107 138.0 AGCGCGUAGUCGUAGUUUUGAC CACGUCACUAAGCUGCGCGUAG
266 GCTGCCGCAGTTGCTGGAGCGCGGCCTGCTACACAGCTACTTTGAAGACGTGGAGCGCGCTGCGCAGGGCAGACTGCGTCACGGC 248 MR383 Reverse 32722 32806 85 127.2 UGGAGCGCGGCCUGCUACACAG UGGAGCGCGCUGCGCAGGGCAG
267 TCGAGAACTGTCGCGGTTTCGCAAACACGTCCACGATCTGAAGCGCATTCGCTTCACCGAGGACACGTTCGTGGAGACCTTCTGCGACTTTCTCGA 124 MR389 Reverse 33570 33665 96 140.4 UGUCGCGGUUUCGCAAACACGU CUUCACCGAGGACACGUUCGUG
268 GGCTGCTGCGCGCCAGTATACGTCACGAGTACACGGCGTGTATACGTATGTTGAGCGGGGACGTGCAGCGGCT 188 MR392 Reverse 33732 33804 73 132.8 CGAGUACACGGCGUGUAUACGU ACGUAUGUUGAGCGGGGACGUG
269 GGGGGCGTCGTGAAGGAGGAGACTGTGATGACTAGCTATATAGCCGCTGTCTGGCTTTACCGCCGTCGCTCCGCGTCGCTTCGCCGCC 281 MR409 Reverse 35030 35117 88 125.2 UAGCUAUAUAGCCGCUGUCUGG UGGCUUUACCGCCGUCGCUCCG
270 CAGAAATAGGGCGACGGTGTTTTTATAACCGAAAGTAGCGTGTTTGAGACACGCGCTTCTGGTCGGTTTTTTCACCGTCGTCGCTCTAGGTTTG 368 MR430 Reverse 36160 36253 94 120.9 UAACCGAAAGUAGCGUGUUUGA GCGCUUCUGGUCGGUUUUUUCA
271 CCTCTGCCTGGGCACGCGCGTCGGCCGCGTCGCAAACGCTGCTTGGTACCCGAGGTCTTTTGCACGCGCGACTTGGCCGACCTGTGCGTGCGACGCGACTATGAGGGCCTGCGGCGTTACTTGCGGCGCTTCGAGGGCTCGTGCGTGTCGCTGGGCTGG 17 MR443 Reverse 37123 37281 159 170.4 CACGCGCGUCGGCCGCGUCGCA UGCGUGCGACGCGACUAUGAGG
272 GCACGCGCGTCGGCCGCGTCGCAAACGCTGCTTGGTACCCGAGGTCTTTTGCACGCGCGACTTGGCCGACCTGTGCGTGC 191 MR445 Reverse 37191 37270 80 132.0 CUUGGUACCCGAGGUCUUUUGC CGCGACUUGGCCGACCUGUGCG
273 GACGGGCTCTCGCGCCGTCAACAGCGTGCCTTTTGCCGCGCGGGTCGCGTGTTGACGGACCCGGAGCCCATC 73 MR453 Reverse 37651 37722 72 148.9 UCGCGCCGUCAACAGCGUGCCU CGUGUUGACGGACCCGGAGCCC
274 GCTCCTGATACGCGCCGACAGCTGCAGCACGTGGAGACGCTGCGTCGGTTTCTACGCGGCGACAGCTGCTTTGTGCACGATCTCCGGGGC 333 MR454 Reverse 37738 37827 90 122.4 CGACAGCUGCAGCACGUGGAGA UUUCUACGCGGCGACAGCUGCU
275 CCGCAGCCGCTACCTCTTGCTCCGCGGTTTTCTCGCCCACCTCGCTCGTCGCTGTTGCCGCCACCGCAGCGGCGGCGACGGACGGCGGCGGTAACAGCAGCTCCGTGAAGCTGACGAGCGGCAGCGG 278 MR464 Reverse 38393 38519 127 125.3 CACCUCGCUCGUCGCUGUUGCC CGGCGACGGACGGCGGCGGUAA
276 ATGGACACCAAGTACGACTCGTAGGCCGTCAGGTGCGAGGCCGAACGGTGAATCTTGGCGTGGCGCACGCAGCGGCCGTAGTTGTCGCGGTCCGCGTCGCGTAGCGCTTCGATCCACGAGGTCACCACGTCCTGCGCCGGCAGACGATAGTCCTGCTCGGGGTCCAT 270 MR466 Reverse 38660 38826 167 126.1 UGGCGCACGCAGCGGCCGUAGU UCACCACGUCCUGCGCCGGCAG
277 GGCAGGCGTGCGGCACGAAGGGCACCATGACCAGTTGTGTGTGCAGAAAACCGATCTGCACCGCCTGCGACTGCCGCATGGTTTCCTCGTCGTAAACCGCC 130 MR475 Reverse 39070 39170 101 139.7 CACCAUGACCAGUUGUGUGUGC UGCACCGCCUGCGACUGCCGCA
278 GTGGCGATGGGGGTGCCCTGCGGGATCACGATGGAACGCGTGCGCGTCCACAGCGTGACTTTGAGCGGCTCGCCGCCGCGCCAC 415 MR483 Reverse 39880 39963 84 117.0 GAACGCGUGCGCGUCCACAGCG UUGAGCGGCUCGCCGCCGCGCC
279 ACGTGCGCAGGTCTTGGGAGGAGCTGGAGCGCAAATGTCTGGCGCGCATTCAGGAGCGTTGCAAGCTGCTGGTCAAGGAGCTGCGCATGT 116 MR507 Reverse 42621 42710 90 141.9 GCAGGUCUUGGGAGGAGCUGGA AGGAGCGUUGCAAGCUGCUGGU
280 TCGAGGTGCGTTGCGCGGCCGTGGCGCGTCGCGGCTACACTTACCCGTTCGGTGATCGTGGTAAGGCGCGTGACCACCTGGCTGTGCTAGACCGTACCGAATTCGA 214 MR509 Reverse 43001 43106 106 130.1 CGUGGCGCGUCGCGGCUACACU AUCGUGGUAAGGCGCGUGACCA
281 GATGGCGGATAGCGGCTCCGTTATGTTACAGGTGATGTTGACATGCGGAGTATCGGTACTGCGGTT 399 MR517 Reverse 43562 43627 66 118.6 UUACAGGUGAUGUUGACAUGCG ACAUGCGGAGUAUCGGUACUGC
282 GACACGTAAGGCGTCTGTAGCGCCACGAAGGAGATGAGTAACACGCTGACGAAGGTTAAAGTGCGACTCCTTTGTTTTTGAGACGCACGCTGTACGGTT 208 MR526 Reverse 44221 44319 99 130.9 UGACGAAGGUUAAAGUGCGACU UAAAGUGCGACUCCUUUGUUUU
283 AGACACGCTGCGTTTGGCGTGCTGATTGCAGTTTTTGCTACTGGTGTCTAATGACGTAGCAACTGATTGTGAATTGTTGCCAGCCGCTAGATTTGTCT 26 MR535 Reverse 44562 44659 98 164.5 UGUCUAAUGACGUAGCAACUGA CGUAGCAACUGAUUGUGAAUUG
284 GCGCGCTTGAGCTGTGCGATGCCCTGGTGGAACTTGCGGTAGTCGCGCTCGGTGCAGAAAACGAAGAGGTTGCTGTTGCGGCGCGAGCAGCCGCCGGGCGGCACGGGCAAGTGCTTCAGCAGCAGCTTCTTCTTGCCTTCGGCGCGTACCGTGCCCTTGTACGCTTTGGAAATCGAGCCTGC 39 MR547 Reverse 45219 45400 182 156.5 UUGCGGUAGUCGCGCUCGGUGC UGCUUCAGCAGCAGCUUCUUCU
285 GCAGCTGGGCCGTGAAAACCAGCTGGTTGAAGAGCGCGCACACGCGCGACACAGCCGTCTGCAGCTCGTCGGCCGGCGTGGGCGGCTCGCGGAGACTGGGCTGC 153 MR549 Reverse 45461 45564 104 137.2 CUGGUUGAAGAGCGCGCACACG UCUGCAGCUCGUCGGCCGGCGU
286 GACGACGGGCGTTGCGGGGCTTCTTGGAATCGTGAAGCGGCGCCGGGTCGCTGTGACGGAGCTCGTCGTC 10 MR561 Reverse 45993 46062 70 174.9 GGGCGUUGCGGGGCUUCUUGGA UCGCUGUGACGGAGCUCGUCGU
287 GCGGCGACTCGCACAGAGGTCTGGCTGGCTAGAGGTCCGTCTTCTTCGTCGGCGCGATGCCGCAGGGCGGTCGCTAGCGTGTCGCAGCGTTCGCCACCGTTGCCGTCGTCGTTGGAGACGGAGGGTTCTGCCCGCAGGAATGCTGCGGTTGCCTTGC 98 MR562 Reverse 46138 46294 157 144.6 GUCCGUCUUCUUCGUCGGCGCG CAGCGUUCGCCACCGUUGCCGU
288 GACTGCTGTGTTGCCGCGCAAGTTCCAGCCCACGCACCAGCGTGACGAAAGTCTGCCGCGTTTCGGGGGCTTGCGTGTAACAAAAGTAAAGCGCGTC 449 MR569 Reverse 47262 47358 97 115.6 AGCGUGACGAAAGUCUGCCGCG CGCGUUUCGGGGGCUUGCGUGU
289 CGCCTTCGCGCGCCGTGGGATCGGCTTCGAGATCGAGCTGGGCCTCGCGCGGCTCGCCGTCGTTCTCCTGCTCTTCGTCCTCGTCCCCGAACTCGCCGCGCTCGCGGGCG 226 MR571 Reverse 47492 47601 110 129.0 UGGGAUCGGCUUCGAGAUCGAG CCCGAACUCGCCGCGCUCGCGG
290 AGGTAAGCCCCACGTCGTTGAAGACACCTGGAAAGAGGACGTTCGCTCGGGCACGTTCTTTCCAGGTGTTTTCAACGTGCGTGGATTTTTTCT 12 MR606 Reverse 49836 49928 93 171.3 UUGAAGACACCUGGAAAGAGGA UUCUUUCCAGGUGUUUUCAACG
291 CCTCTTACGAGTTTCTGCAGATGAACCTGAGCAAGATCAGTTGGCTGGAGCGACACTGCCCCCCGTTGGACCAGGAGCTCATCATGTTCGGGGTCATCGAGGCCTGGGAGG 23 MR643 Reverse 52165 52275 111 166.5 ACCUGAGCAAGAUCAGUUGGCU ACCAGGAGCUCAUCAUGUUCGG
292 GCTGCGGCACGACTCGGGTCTCTACGTGTGCATCTGCGACCCCTCTTACGAGTTTCTGCAGATGAACCTGAGCAAGATCAGTTGGCTGGAGC 65 MR644 Reverse 52225 52316 92 150.1 GGUCUCUACGUGUGCAUCUGCG UCUGCAGAUGAACCUGAGCAAG
293 CGCAGATGGACGTGGGGGGACTGATCCAGGCGTCGGCGTTGGGCAAGGTGGCGCTTCGCTACGCGGTGAGGAAACTGATGAAGCGCGGAGCCAGGCTGCGGCACGACTCGGGTCTCTACGTGTGCATCTGCG 356 MR645 Reverse 52279 52410 132 121.4 CGUCGGCGUUGGGCAAGGUGGC CGGGUCUCUACGUGUGCAUCUG
294 CCATGGACGCCGAGGGCCTCTCAGGACTTGCGCGAGAAGCCTGCGAGGCTCTCAAAAAGGCCCTGCGGAGGCACCGGTTCCTGTGG 315 MR652 Reverse 52629 52714 86 123.6 AGAAGCCUGCGAGGCUCUCAAA UGCGGAGGCACCGGUUCCUGUG
295 CATGTCCGGCATCTTCATGTATATAAGACGGTGTTTCAAGACGACGTGAGACCCACACGCGGGTTTCACTTCTTTCTTTAATTATGTCTCCAGTCTACGTGAATCTGTTAGGTAGCGTG 216 MR658 Reverse 53025 53143 119 129.9 CGGCAUCUUCAUGUAUAUAAGA UUUCACUUCUUUCUUUAAUUAU
296 CACGTGTCTTGGGCGCGTCATGTCCGGCATCTTCATGTATATAAGACGGTGTTTCAAGACGACGTG 291 MR659 Reverse 53096 53161 66 124.5 UGUCUUGGGCGCGUCAUGUCCG UAUAAGACGGUGUUUCAAGACG
297 GCCGTCAGTGACGTGAATCGCCCCTCACGTCAGTGTTGTCCCCTATCCGCGTGAGTTGGGTGGTTCACCGTCAGGT 280 MR661 Reverse 53288 53363 76 125.2 CGUGAAUCGCCCCUCACGUCAG CGCGUGAGUUGGGUGGUUCACC
298 TCATTGCTGCTACGGAATAATAACTACGCTACGACCTGGCCTGTGGTGTGTGTTGTTTTTTGTGCACGCACGACATGA 217 MR676 Reverse 54634 54711 78 129.8 CUACGGAAUAAUAACUACGCUA UGGUGUGUGUUGUUUUUUGUGC
299 CACCACGGGGGCGTACTTTGACAACGGCTGGAAATGGACTTTTGCTCTCTTAGTGGTCGCTATATTAGGGATCATTTTCTTGGCCGTGGTGTTCACCGTGGTG 434 MR679 Reverse 54796 54898 103 116.2 UGACAACGGCUGGAAAUGGACU UUAGGGAUCAUUUUCUUGGCCG
300 GGGCTCTTTGCTCGAAGGTGAGCCGCGGACGCCGTCGGTACCGTCTCCACCACAGTTACCACCGTCGCCGTCACTGCCACCGACATGGAGCCC 310 MR684 Reverse 55111 55203 93 123.9 CGCGGACGCCGUCGGUACCGUC AGUUACCACCGUCGCCGUCACU
301 TTTGCCTCTTGGGACTTGATCGAGCGCATCTTTGAGCACATGTACTTTGCCGCGGTGCGCGCTAGCGTCGATTTGTGCAAGTCGGGTTTGCCGCGCTGCGAGTGGTTCGAACGCACCATCTATCAAGAGGGCAAA 301 MR721 Reverse 58465 58599 135 124.2 AUCGAGCGCAUCUUUGAGCACA GGGUUUGCCGCGCUGCGAGUGG
302 CTGGGGGGATACTGCGATTTGATACGCGAGAAGGAGGTGCATCGACCCGTGGTACGTGTGTTTGTGGACATGTGGGACGTGGCCGCTATCCGCGTGATTAACTTTATTCTCAAAG 308 MR730 Reverse 59250 59364 115 123.9 CGCGAGAAGGAGGUGCAUCGAC UGUGGGACGUGGCCGCUAUCCG
303 GCCGTCGATATCGGAACTGACGAAAGAGCTCATGTGCCGCACGCTGTTCTTGACGTAGTTTTGAAACTCCACGGC 149 MR771 Reverse 62436 62510 75 138.0 AUCGGAACUGACGAAAGAGCUC UGUUCUUGACGUAGUUUUGAAA
304 GCTGACGTCACGCATGTGTTCGGCACCGGGCTTCTGGTCGCCGTCGATATCGGAACTGACGAAAGAGCTCATGTGCCGCACGCTGTTCTTGACGTAGT 165 MR772 Reverse 62452 62549 98 135.4 ACGCAUGUGUUCGGCACCGGGC GAAAGAGCUCAUGUGCCGCACG
305 GGCGTAGTTGACGCGGCCTTCGTTCAGATTAACGAGCGCGCATTCGCGTAAGATGTCGGAGCGTGTGACGCCGTCAAGCGGAGGCAAAGGCGAGGCCGCGCC 178 MR782 Reverse 63255 63356 102 133.7 AUUCGCGUAAGAUGUCGGAGCG GAGCGUGUGACGCCGUCAAGCG
306 GGACCTCCGGTACGGACGTCGCGCCTGCCGTTGATTCTTCGTGATCGGTGTCGGGCGTCATGCGGAGTCGCGGCGGTTGGGGCGCCGATTCCCAGGGCGCCTCCAAGAACTCGCGTAAGGCGCCATCCGCTTCGGCCGCCGCCGCAACGCCCGTGCCCGCGGGCCAGGTCATCGGCGCTAGCGCGCGATGTCGGTGCAGTAGGCTC 106 MR793 Reverse 64271 64475 205 143.6 ACGUCGCGCCUGCCGUUGAUUC UCGGCGCUAGCGCGCGAUGUCG
307 GGACGACGCCGGTGAGGTCGATATCGCGGTCGCGATAGGTGGAGACCAAACGCGCGGCGATCTCAGCCTCTGGTACGGTCGCC 382 MR804 Reverse 65248 65330 83 119.5 GGUGAGGUCGAUAUCGCGGUCG CGCGCGGCGAUCUCAGCCUCUG
308 TACCTCGTCGACCAGCTGTTGGTAGCGGCCCAGGGCCGGCAGGGCCCCTTCGCCGCAGCTGTAGGACGGTGGTA 335 MR809 Reverse 65613 65686 74 122.3 ACCAGCUGUUGGUAGCGGCCCA CCCCUUCGCCGCAGCUGUAGGA
309 GGCTTGCTTTCCACGTAGCGCAGCATCTCCTCCACCCAGGCGATGAGCGCCGGGCCGTGCTGACGTCCGTAGGGATCGAAGACGACTTGCATTTTCTCCAGCAGTGCGCGATCCAGCGTCGAGTACGTGCCTTTGGTGGTCTTGTGGCTCAGGTAGTCGTGCATGCGCTGCAGATCCAGGCC 177 MR814 Reverse 65978 66159 182 133.9 AUGAGCGCCGGGCCGUGCUGAC UGCGCGAUCCAGCGUCGAGUAC
310 GCGTGGCTTGCTGGTACGCGTGTCGCAGCTGCAGGATCTCTTGCAGTAGCGGTACGTTGTCGCGCACAGTGCCCGT 296 MR826 Reverse 66695 66770 76 124.3 CUGCAGGAUCUCUUGCAGUAGC AGUAGCGGUACGUUGUCGCGCA
311 TTCTGTAGGCGCTGCTGCACTTCGGGTAGCTGCAGGCCGCCTAGCGCTTCCAGCTGAGCTAGCTGCTCCTGTACCAAGGCCAGTGTCAGCGCCGAGCCGCGGCTGCCCGGGTCGCGCACCAGCGTCTCGATGACATGAA 164 MR828 Reverse 66810 66948 139 135.4 UAGGCGCUGCUGCACUUCGGGU AAGGCCAGUGUCAGCGCCGAGC
312 GCAGATCCTCACGTTCATGCGAGTCGGGTGGCAGTTGCTGCAATAACAGACTGACGGCGTCAAAAAACGTCGGTCGCGGCGACTCGTCGCGCGCCAGTCGCATCACTAATGTGTGGAACATGC 250 MR834 Reverse 67125 67247 123 127.0 UGCUGCAAUAACAGACUGACGG UCGGUCGCGGCGACUCGUCGCG
313 AATTCGCTACCCGTGATGGCTGTAGTTGGATCGCCCTGTTGACACTTCTCGATGAACTGCGCTTGATGGACGGCGTGTTGCAGGGCCTGCTGCGTCTCATGGATCAGGAGTT 407 MR841 Reverse 67998 68109 112 117.5 CUGUUGACACUUCUCGAUGAAC AUGGACGGCGUGUUGCAGGGCC
314 CGGGCCGCGTCGGCCTGCTGATCTAGCAGCGTTTTGAAGACGGGCCGCTGGAAGTCGGCGGGCGGGGGCGTGATCCG 380 MR844 Reverse 68291 68367 77 119.6 CGUCGGCCUGCUGAUCUAGCAG GGCCGCUGGAAGUCGGCGGGCG
315 TTGTGGCGCGTGACCAGATCAGTCCACAGGTTCTGCGCCGTGCTCAGCTGCTCGTCGCGTTGTCGCAA 457 MR845 Reverse 68420 68487 68 115.0 CGCGUGACCAGAUCAGUCCACA CUCAGCUGCUCGUCGCGUUGUC
316 GCTGCCAGACCGCTTCCACCGCCTGGACCATGTCGACCCGCGGCGTGGACGCGCCGTTGGCAGT 254 MR851 Reverse 68807 68870 64 126.8 ACCGCUUCCACCGCCUGGACCA CGCGGCGUGGACGCGCCGUUGG
317 GGCCGTAGGTCGTACTGCGAGATCTGCGGCCAGAAAGTGCGCAATGTCTGACAGACGGCCACGGCT 129 MR860 Reverse 69577 69642 66 139.7 UAGGUCGUACUGCGAGAUCUGC AAUGUCUGACAGACGGCCACGG
318 GTAGCCAGCAGTGCTCCAGCGGCGTTTCGGTCCACGTGTCCTGGAGCAGTTGACTGAGATTGAGGTCCCGGGAGCGTTGGATGC 238 MR877 Reverse 70593 70676 84 128.0 UCCAGCGGCGUUUCGGUCCACG UGACUGAGAUUGAGGUCCCGGG
319 GTCCTTGATGTATCGTCTTGTGCGTGATCTATCTGTCCGTCGTCGTCTGCGGCCGCGGCCGCTCGATGACGATGTCGGCGCGGCGGCTGCTGAACTCGTGCGATGGGTGGCGGGTTTTCACGCAGAAACTGAATATTGACTGGTAC 60 MR884 Reverse 70937 71073 137 151.7 CGUCGUCGUCUGCGGCCGCGGC CGCGGCGGCUGCUGAACUCGUG
320 GCCGCTCGATGACGATGTCGGCGCGGCGGCTGCTGAACTCGTGCGATGGGTGGC 321 MR885 Reverse 70972 71025 54 123.4 UCGGCGCGGCGGCUGCUGAACU UGCUGAACUCGUGCGAUGGGUG
321 TGCAGCTGGTGATCGGCCGCGGTGCGCTGCAGCCGGAGGAAGCGGCGGTAGAAACGTCGCAGCCACCGGCGCAGTTTGCGGCGCAGACGTCGGCGGTCCTCCAGCAGCA 132 MR914 Reverse 73184 73292 109 139.5 AUCGGCCGCGGUGCGCUGCAGC AGCCACCGGCGCAGUUUGCGGC
322 TCCTCCTCCTCGTCATCCGAGTTGCTCTCCCACCATGGTCGCCGCTGGCGGCGCCGCTGCCGGGCCTCGGCCGCCGCCGCCACCCATGGCGGCGGGGTCGTGGCGGCTGTGTCGTTGTGAGGCCTGTATGGGACGATGCGGATGCGCAAGCGAGGGAGA 46 MR922 Reverse 73740 73898 159 154.4 AUGGUCGCCGCUGGCGGCGCCG CGAUGCGGAUGCGCAAGCGAGG
323 GCTGTACGCCAAGAAAGCCGCGTCGACGTCGTTGGCGGTCCGGAACCACGTCACCGTAAGCAGTCACAGCGGCAGTGGTCCATCTCTGTGGCGCGCCCGCATGTCGGCCGCGCTCACGCGAACGGC 127 MR923 Reverse 73935 74060 126 139.9 CGUCGACGUCGUUGGCGGUCCG UGGCGCGCCCGCAUGUCGGCCG
324 TGCCGCCGCACGTGGTTTCTTCCGCACAGCAGTTGAGCAGTTCGTCTACCTCCGAGGTGCCGAGGCTGAGCGTCTGGAATTCGTAGTGACGGTA 104 MR946 Reverse 75396 75489 94 143.6 UCCGCACAGCAGUUGAGCAGUU GCCGAGGCUGAGCGUCUGGAAU
325 CGTGGATAACGCGTCTAGTCGCGCGAACTTAGTGTGCGTAAGTTCCGTGAGTGGCGTGGTGCTCATG 257 MR954 Reverse 76190 76256 67 126.7 AACGCGUCUAGUCGCGCGAACU UUCCGUGAGUGGCGUGGUGCUC
326 CTCGTTGGTGACGCGGATGTTGCCGGCGCACTGCGGGTCGCAGAAAAAGTGCTTGTAGATGCCCGTGACGCCCGCCTGACGCAG 244 MR960 Reverse 76752 76835 84 127.7 AUGUUGCCGGCGCACUGCGGGU UGUAGAUGCCCGUGACGCCCGC
327 GCAGGTCGTGCAGCGTGAGGCGCGGGCGCGCGTCGGCCGGCGACGGCGGTTCGCCGTGGTTGTTGGCCGACGTAGCGCCGTTCACCGTTGACGCCACTTTGC 6 MR966 Reverse 77177 77278 102 180.5 GCGGGCGCGCGUCGGCCGGCGA UUGUUGGCCGACGUAGCGCCGU
328 GCCACCATGGCGTCGGAGGCGGTGGGCAGGATGCGGTTGTCCTCGCACGAAGTGCAGGCGATGCGCGAGACCTGCTCGTTGCCGTACGGCGAGATGTCGAGGC 354 MR969 Reverse 77402 77504 103 121.6 UCCUCGCACGAAGUGCAGGCGA AGGCGAUGCGCGAGACCUGCUC
329 GTTGAGCGTGACGCTGTAGTCTTCGCGCGCCGCCGTGAGCATCTGCGTGATGCAGTCGCAGGGGATGTGCACGTCGGAGTTTTCGAAGATGACGTGCATGTGCAAC 61 MR973 Reverse 77679 77784 106 151.7 CGCGCGCCGCCGUGAGCAUCUG UUCGAAGAUGACGUGCAUGUGC
330 TAGCGCTCAAAGGACTCGCTCACGTCGTTGGGAATGTCCATCTCGTCAATCTTGCGTTGCAAAATAGTCACGTCGATCTTGACGCTGCTGGCCGAGACGGCGTGACACAGCACGCTGATAACGACGTGGTCGCGCACGATGTTGAGCGTGACGCTG 418 MR975 Reverse 77769 77924 156 116.6 CCAUCUCGUCAAUCUUGCGUUG ACGGCGUGACACAGCACGCUGA
331 ACGGCGCGGTTCATCAAAGACAACTTTTCAGAGCCGTGTTTTTTGCACAATTTTTTTAATCAGGAAGACTATGTAGTAGGAACGCGGGAGGGGGATTCGGAGGAGAGCAGCACGT 179 MR992 Reverse 79267 79381 115 133.5 UGUUUUUUGCACAAUUUUUUUA AGACUAUGUAGUAGGAACGCGG
332 TGACACACCGCTTTGTGCGTGCTTCGGTGCGCGTCTCGGTGCTTTCGGAACTGCTCAACAAGTGGGTTTCGCAGCGGCGTGCCGTGCGCGAATGCATGCGCGAGTGTCA 22 MR997 Reverse 79539 79647 109 167.0 CCGCUUUGUGCGUGCUUCGGUG UGCGCGAAUGCAUGCGCGAGUG
333 GAGTACCCCGTGGACCCTGCCGACGTATACAGCGTCACGCTAGAGAACGGCGTGACACACCGCTTTGTGCGTGCTTCGGTGCGCGTCTCGGTGCTT 323 MR999 Reverse 79604 79699 96 123.3 UGCCGACGUAUACAGCGUCACG CGUGACACACCGCUUUGUGCGU
334 TTACCTGCGGCAACGCAAGGATGACCTGTCCTACAAGGACATCCCGCGTTGTTTCGTGGCTAA 219 MR1008 Reverse 80340 80402 63 129.6 ACCUGUCCUACAAGGACAUCCC ACAUCCCGCGUUGUUUCGUGGC
335 TACGAGGTCCGTGTGGATCCGCTGACGCGTTTGGTCATCGATCGGCGGATCACCACGTTCGGCTGGTGCTCCGTGAATCGTTACGACTGGCGGCAGCAGGGTCGCGCGTCGACTTGTG 128 MR1019 Reverse 81106 81223 118 139.8 CGUGUGGAUCCGCUGACGCGUU GCGGCAGCAGGGUCGCGCGUCG
336 ATGGCCAGAAAAATCGGCGAGTATCTGCTGGAGCAGGGTTTTCCCGTGTACGAGGTCCGTGTGGATCCGCTGACGCGTTTGGTCAT 426 MR1021 Reverse 81186 81271 86 116.5 UGGAGCAGGGUUUUCCCGUGUA UGGAUCCGCUGACGCGUUUGGU
337 CGTCAGTCGGCATAGCGAGCGGCCCGCGAGTTATTTGTGCACCGACTCCATGTCTCTGGCCGGCGCCAGACCGGACGACAGCGTCTCGTACGTGAGCGAGTCGAGTCATGGAGATGAATTTGTTACAGAAACTATGCGTAGTGTGTTCGAAATGCAACGAATACG 312 MR1090 Reverse 87247 87411 165 123.8 AGCGAGCGGCCCGCGAGUUAUU CGUACGUGAGCGAGUCGAGUCA
338 GGGGGTGGCGGTCTTCTTCTCGGCGAGTCCGTCGCGGGCAACTCCATTTGCTTCGGCGTGCCCGGCGAGACGGGAGGTGGCTGCTTTC 47 MR1099 Reverse 87969 88056 88 154.4 CGGGCAACUCCAUUUGCUUCGG CUUCGGCGUGCCCGGCGAGACG
339 ACTTGCGACGCGTGCTGGACGCCGACGCCCAGCGATTAACGGACGCCGCCGGGGGGGAGGTGCACGACCTGTCGGCGCTCTTCGCGCCCAGTGGCGTCGGCGCGGCGTCCGGCGTCGGGGGT 176 MR1101 Reverse 88051 88172 122 134.3 GGACGCCGCCGGGGGGGAGGUG UCGGCGCGGCGUCCGGCGUCGG
340 TCAAGGGCTTGAAGACCGCAGGCGTGCCGGCGCCCATGGCCGCCACTGTGGCGCGTGAATCGTTGGTACGGAGCGTTTTTGAGCATCGTTCCTTGG 237 MR1109 Reverse 88623 88718 96 128.1 UGCCGGCGCCCAUGGCCGCCAC CGCGUGAAUCGUUGGUACGGAG
341 TCGTCTGGTATCTAAATCGTGTCTCGGTGTATAACACGGGCTTGTCGGGTTCGTCGACGCTCACGAATCACCTGGTGGGCTGCGCCGCGGGGCTGTGCGAGGCCTGTGGGGGTACTTGTTGCCACACGTGTTATCAGACGG 119 MR1126 Reverse 90120 90260 141 141.0 UAUAACACGGGCUUGUCGGGUU UUGCCACACGUGUUAUCAGACG
342 CGTGTGCTGATCGAGGCGGCGTTGCGGCAGTTTGTGCACGACAGTCAGCAGTCGGTGAAGCTGGCGCCACATAAGCGCTACTTGGGGTACATG 51 MR1137 Reverse 90757 90849 93 152.9 CGGCGUUGCGGCAGUUUGUGCA AUAAGCGCUACUUGGGGUACAU
343 GACGAGGTCTCGCTGGATGCGCGCAGCGCTTTTGTGGAGGCGCGAGGGCTCTACGTGCCGGCCGTAAGCGAGACGCTTTTC 247 MR1139 Reverse 90898 90978 81 127.2 UCGCUGGAUGCGCGCAGCGCUU CGGCCGUAAGCGAGACGCUUUU
344 GACGTGCATCGGCTGTGCGAGGACGCCCGCCAGAAGTACGCGTTGGAGGCCTACACGCCCGAGGCGGATCGCGTGCCTACCGATCTGGCGGCGTTGTGCGCGGCGGTGGGCTGTC 232 MR1144 Reverse 91161 91275 115 128.7 UACACGCCCGAGGCGGAUCGCG UGGCGGCGUUGUGCGCGGCGGU
345 GTGATCGCTCCTCTGTTGGCGGGGCTCACGGTGGAGGCGGATTTCGGCGTCTCTGTGCGTACGCCTGTGCTTTGTTACGACGGCGGGGTGCTCAC 200 MR1149 Reverse 91355 91449 95 131.4 UUGGCGGGGCUCACGGUGGAGG UGCUUUGUUACGACGGCGGGGU
346 GTGCGTCGGCTAGCGGTCTGGCTGCGAGAGGCTACCCGACCGTAGCGGTTAGCTTTTCTTACGAATTGCTGGGATCGTTGCGGTTGTCGCCTTTGGTGGTCCGCAACCGCAGCCAGACCGCAGTGGTGGCCACG 230 MR1152 Reverse 91681 91811 131 128.9 CUACCCGACCGUAGCGGUUAGC UUGCUGGGAUCGUUGCGGUUGU
347 GCGGTTCTTTGTGATTTAAAAACACCGTGTTCGTGAAACGTGACTTTTCACGGTTTGTTAGCTGATGTGATTTTGGAGGTCACAAACACCGT 144 MR1155 Reverse 92065 92156 92 138.3 UGAAACGUGACUUUUCACGGUU UGAUUUUGGAGGUCACAAACAC
348 GCGGGTTTTTGGGGTGTGTAGCTTGTACGACGTTTTGTCGGCGGAGCGCAGCGAAAATCGGTGGTGATAGCGGCGATTGAGGTTGCGAGACCAGATTCATCGCGCTTGTACCACCGTGGTGCGGTGTTTCTGCTTGTAAACCGTTAGGCGGTTCTTTGTGATTTAAAAACACCGT 143 MR1156 Reverse 92129 92303 175 138.4 UGUACGACGUUUUGUCGGCGGA AUUCAUCGCGCUUGUACCACCG
349 TCACTAGGGATCGCTGTATTCTACCGCGCGCGTGTGCGCGCGTGCGCGTGTGCGCACACGCGTGACGTAACAAATCACCTTGTGA 193 MR1167 Reverse 93009 93093 85 131.9 UACCGCGCGCGUGUGCGCGCGU CACACGCGUGACGUAACAAAUC
350 CCCCGGCCGAGGTCCGGAGCGGGCCGCGCCCGGTGCCCGGCCCACGGCCCCGGATGGTGCTCCAGGGCGGTGGGACGGGCCCGCGGACGGACCGGCGCCGGGCCTCGGCCGGGG 13 MR1184 Reverse 94412 94525 114 170.8 CGCCCGGUGCCCGGCCCACGGC AGGGCGGUGGGACGGGCCCGCG
351 GGACCCCGGTGCGGGGGTCCCAGCCCGGCCGGGCCGTCGGATGGGGGGTCGAGCGGGGGGAGGGCAGGGACCCCCGGCCGAGGTCC 96 MR1187 Reverse 94511 94596 86 144.7 CCGGUGCGGGGGUCCCAGCCCG GCAGGGACCCCCGGCCGAGGUC
352 CCCCCGCTCGGGTCCCCCCGGGCCGCGGACGGGAACCGGGACCCCGGTGCGGGGGTCCCAGCCCGGCCGGGCCGTCGGATGGGGGGTCGAGCGGGGG 21 MR1188 Reverse 94538 94634 97 168.6 CGGGUCCCCCCGGGCCGCGGAC UCCCAGCCCGGCCGGGCCGUCG
353 GGGGTGGGAAGCCCCCGCTCGGGTCCCCCCGGGCCGCGGACGGGAACCGGGACCCCGGTGCGGGGGTCCCAGCCC 450 MR1189 Reverse 94571 94645 75 115.4 AGCCCCCGCUCGGGUCCCCCCG CCCCGGUGCGGGGGUCCCAGCC
354 GCAGCGAGGGATCCCGGGCCGGAGCCCGGGGAGGAGCGGGGTGGGGGTGGGAAGCCCCCGCTCGGGTCCCCCCGGGCCGCGGACGGGAACCGGGACCCCGGTGC 133 MR1190 Reverse 94585 94688 104 139.4 CCCGGGCCGGAGCCCGGGGAGG CCCCGCUCGGGUCCCCCCGGGC
355 CCCGGTCGCCCACCGCGGAACGAGCCTAGGAACCGGGGTCCGCGACCCAGCCCCCCGTGGGGGGAGGGGAAGGGCGCGGACCCCGGGTCCCGTCCGTTCCGCGGCGGGTGGACCGGG 50 MR1191 Reverse 94711 94827 117 154.0 AACCGGGGUCCGCGACCCAGCC AGGGGAAGGGCGCGGACCCCGG
356 CCCAACCTCGCCGCCGCATCGGCCAGCACACACGCCACAGCCTGGTGGGGTCCGAGGCGCCGACCCCGGCTGGGCGGCCGATGGGGGGAGGGGAGTGGG 325 MR1197 Reverse 95281 95379 99 123.1 UCCGAGGCGCCGACCCCGGCUG CCCCGGCUGGGCGGCCGAUGGG
357 TCCCCGTGGATTCACGGTGTTCCGGACCCCTCCAGGAAAGGGTGGAAAACGCGTGGAGCCCACGGGGA 353 MR1207 Reverse 95537 95604 68 121.6 UGGAUUCACGGUGUUCCGGACC GGUGGAAAACGCGUGGAGCCCA
358 CCGTCTGCACCCGTATCGGTTCACGGGTTTTCCACGGCAAAATCGGAGAAGGGAAAAAAAGGTGGGGCCTGTTCCCTTCCCGGGTCTCGGACGAGTCGACACGCCGGGTGGGACGG 430 MR1209 Reverse 95635 95750 116 116.3 CAAAAUCGGAGAAGGGAAAAAA UUCCCUUCCCGGGUCUCGGACG
359 GGCTCTCGACGCCATTTTCTCTCGTCCGCCATGTCGGAGCTCAGAACGGCATGACGAGCGAGAGAACCGTCGAGAAAGTC 304 MR1215 Reverse 95907 95986 80 124.1 UUUCUCUCGUCCGCCAUGUCGG CAUGACGAGCGAGAGAACCGUC
360 CTCGACAGCGCCCTCTAGGTAGCATCACGGAACAGGCGGCGACCGCGGACTCGCCTCGGCCAGGGGGTACCGAGGCGGTGCCCGCGACTCGCCCCTCCTCCAAGATGGCGCCGCTCGGCCAGACTCGTCGAG 322 MR1216 Reverse 96108 96239 132 123.4 CGGCGACCGCGGACUCGCCUCG UACCGAGGCGGUGCCCGCGACU
361 TACGTGTGTGTTTTTTGCTTTGGTCGGTACACGGTCCCTTTCAGCGGACCCAGTGTTCCTTGGAGAGACGAAAAGCGAGCGTG 203 MR1244 Reverse 98039 98121 83 131.2 CGGUCCCUUUCAGCGGACCCAG CCCAGUGUUCCUUGGAGAGACG
362 AAAAGAGGCTCAACGAGCACCAAAGGCTAAGTCGGAAAACTCGCGCCCGCTTCCCCGGACGGTTTCGGCTTAGCCTCTGGCCTGCGATGGTTTTTTTT 140 MR1247 Reverse 98198 98295 98 139.1 AAAGGCUAAGUCGGAAAACUCG ACGGUUUCGGCUUAGCCUCUGG
363 TGTGGCCGACTTTGATTTACGGCTGCGCGACGGCGTCTCCGGTCTGGCGCGACACACCGTCTTTGAGTTATGTCGCGGACTACGACGCGTCTGGATGACCGTATGGGCGAGCCTCTTTGGCTACA 141 MR1298 Reverse 103022 103146 125 139.0 GCGUCUCCGGUCUGGCGCGACA UAUGUCGCGGACUACGACGCGU
364 GGGCTCGACCGGCGGCTGCTGTTGCACGGGCTCGGGTGACGGCGACATCACGGTCACTTCATCCTCCTCGTCGCCCTCTTCCAGCAGCCGCTGGTCGAACCT 115 MR1334 Reverse 105426 105527 102 142.0 UUGCACGGGCUCGGGUGACGGC UCCAGCAGCCGCUGGUCGAACC
365 ACGTGAGGGATCCCAGCCGCTGCGCACGCTCTCGGTCACGGCCAACAGAGCCAGGCCGGGAAAGAGCTGCGACAGCGTGACCGCGGGGTCGCGCGCGT 205 MR1410 Reverse 113737 113834 98 131.1 CAGCCGCUGCGCACGCUCUCGG AGGCCGGGAAAGAGCUGCGACA
366 GGTACAAGCGATACGCGAGACCGTGGAACTGCGTCAGTACGATCCCGTGGCTGCGCTCTTCTTTTTCGATATCGACTTGTTGCT 262 MR1488 Reverse 121272 121355 84 126.4 UGCGUCAGUACGAUCCCGUGGC UGCGCUCUUCUUUUUCGAUAUC
367 GCCGTTGTCCCGAAATGATATCCGTACTGGGTCCCATTTCGGGGCACGTGC 358 MR1497 Reverse 122275 122325 51 121.3 UGAUAUCCGUACUGGGUCCCAU UGGGUCCCAUUUCGGGGCACGU
368 CGTTTCAACGTGACCTGCGACCGCACCGAGGCGCCAGCCGACCCAGTGGCGTTTCGCCTGCGGCTGCGACGCGAAACG 406 MR1511 Reverse 123180 123257 78 117.7 UGCGACCGCACCGAGGCGCCAG UUUCGCCUGCGGCUGCGACGCG
369 GGTGCAGACGTTGTTCGTCTCCGCTTCTCCTCCGTCGCGGCCAGGATTTCACCGCCGCTATGGCGGCCATGGAGGCCAACATCTTCTGCACT 288 MR1529 Reverse 125296 125387 92 124.6 UCUCCGCUUCUCCUCCGUCGCG CGCUAUGGCGGCCAUGGAGGCC
370 GACGCTGCTAGTAGACCTCTTTTACCGACCGGCGTTTCTCCTGATGCCGGCCGCCACCGCGGTCTCCACGTCAGGTACGACGTCGAAAGAGAGCACAAGCGGCGTC 355 MR1547 Reverse 127083 127188 106 121.5 CCGGCCGCCACCGCGGUCUCCA UCGAAAGAGAGCACAAGCGGCG
371 GACGACTATTAGAGCGTCACAGCCGAGGCGGCGCGGCGCAGCGCCGGCCATTCTCCGGGTCGCGCTGCTTTCCCCGAGCTCCGACGCCTCGCGCTCACGCCGCCGCCGCGATGGAGAACTGGTCGGCGCTCGAGCTCCTGCCTAAAGTAGGCATTCCCACTGACTTTCTGACGCACGTC 456 MR1570 Reverse 129534 129712 179 115.3 AGCGCCGGCCAUUCUCCGGGUC CGCGAUGGAGAACUGGUCGGCG
372 GCAGGCGAAACGCTGTGGCAACGCGCCGCTGTCCCGTCGTAGTACAGCGTAGATCTCGTCGCGCACGGCGCGAATCAGCACGTACTCGACGGCGATGCGCGCCCGATAAGCGTCCAACGCCCGGT 305 MR1630 Reverse 137069 137193 125 124.1 CUGUCCCGUCGUAGUACAGCGU AUCAGCACGUACUCGACGGCGA
373 GAAAAGACGGCGTGGCGGCGTCGTTTTTCGGAGCGCGTCGTCTACGACGGCGTTTGGCCCGAGACCCACCGCCGTTCTTTTC 290 MR1658 Reverse 140278 140359 82 124.6 AGCGCGUCGUCUACGACGGCGU CGAGACCCACCGCCGUUCUUUU
374 GCAGAAACTGATGCTGCTGTCGCTCAAGGTCGACGCGCATCACGTCCTTTAAGAGCTGTTTGTTGACCGACGTCATAGATTCAACGTGATGAGACCCGCGTCGTTCAGCGAGAGAGCGTCCAGCAACTTGC 212 MR1668 Reverse 141239 141369 131 130.3 CUGUUUGUUGACCGACGUCAUA UCAUAGAUUCAACGUGAUGAGA
375 CTTCGCGCATCCACTGGCGCCGGCGCGCCCTGCTGGGACGACGCAATGGCGGCGGATCCCAGCCCTGAGTCGTCGTTCCGAGCGAGGCCGAGCGAGCCCGAGACCGAAGTGCGGAG 118 MR1673 Reverse 141803 141918 116 141.0 CGCCCUGCUGGGACGACGCAAU UGAGUCGUCGUUCCGAGCGAGG
376 GCAGACGGTGCGAGCAGTTGGGGATGCGGCGCGCCGTGCCCGTCTCCTGAAAGACGGCCACACAGCGCTCGTTGTAATCCGGATAGGGCTCGCTGAGGCTGT 224 MR1689 Reverse 143242 143339 98 129.1 UGCGGCGCGCCGUGCCCGUCUC CCACACAGCGCUCGUUGUAAUC
377 GCCCAGCAGCTCGGGCGTGTTTTCGTCCTCGAAAGGTATCGGCGGCGGCGAATCGCCCGGGCTGCCCCGC 14 MR1716 Reverse 145262 145331 70 170.8 AGCUCGGGCGUGUUUUCGUCCU GGCGGCGGCGAAUCGCCCGGGC
378 CGTCCGAGGAGGAAGTCGGAGGGATGTTGTCGTAGGAGCGTAGAGACACCTGGCGACCCAGAGCATCTTTCAGGGGCTCACCGGACG 381 MR1723 Reverse 145752 145838 87 119.5 GUCGGAGGGAUGUUGUCGUAGG UGGCGACCCAGAGCAUCUUUCA
379 GGCAGCGGCGGCAACAGCCAGCGACGATCGCCGCCGGCCGGTCGCTCGCGAAAAGCCGTGGCATTGAGACGCACGGCGCCGCCGCCGGCC 327 MR1753 Reverse 148931 149020 90 122.9 AGCGACGAUCGCCGCCGGCCGG CGUGGCAUUGAGACGCACGGCG
380 GCGTGGCGTCGCGAACGTGCACGGTGAAAGTAGCGTCGTCGCTCGGCGGGTGCGCACCGCCGGTGCTGCTGCTGACTTCCACGACGTTGTTTTCACCGTCGCCGTCGTCACGC 189 MR1755 Reverse 149021 149133 113 132.6 CGGUGAAAGUAGCGUCGUCGCU GUUGUUUUCACCGUCGCCGUCG
381 TCGGCCTTTCTGGGCTACTCCGCCGTGTTTTTGCTCGAGACCGAAGACGCCGTCACGCAGGTGAGGCTCTCGGATCTGCGGCTCAAACACCGCTGCGGCATCGTCAAGGCCGA 245 MR1779 Reverse 151072 151184 113 127.7 UCUGGGCUACUCCGCCGUGUUU AGGCUCUCGGAUCUGCGGCUCA
382 GGTCCGGGTGGACCCGGCGTGGTGGGACCCGGCGGCGCCGTGGTGGGAGGACCCGCGGGCCACGTCGGGCTGCTGCCGCCGCCACCCGGCC 107 MR1794 Reverse 152148 152238 91 143.6 GGUGGGACCCGGCGGCGCCGUG CGCGGGCCACGUCGGGCUGCUG
383 TGGTGTGGAGCGCCTCGTTGCGCCAGAGCGTGCAAACGGGCGTGCTGGGCGCGCTCCGCGACA 242 MR1811 Reverse 152925 152987 63 127.8 UGGAGCGCCUCGUUGCGCCAGA GGCGUGCUGGGCGCGCUCCGCG
384 CGTCTCGTGGCTAACGGCGCTGTCAGCCAGCGGCACGTGCTTGCTGACGAAGCCGAAGACGCGGTAGATG 357 MR1824 Reverse 153730 153799 70 121.4 UCAGCCAGCGGCACGUGCUUGC UGCUGACGAAGCCGAAGACGCG
385 TGGGCAGACTGAGCACGTTGTCGCTGGTGTAGCCCTCGAGCGTGTACGTCTGCGCCGGCGACACATGCGAAAGCATGCCCA 392 MR1849 Reverse 155607 155687 81 119.1 ACGUUGUCGCUGGUGUAGCCCU ACGUCUGCGCCGGCGACACAUG
386 GACCGATATTATACTTCATTAACTCACGAAGATGACTGTAAGTAAGGATATTGTTGTTCATGATAGTAGCCAGGTTATAAGGATCATATATATCTCGTCAGGGAAATACAAATTAGACCATAATGTTGACTACTTTAGAGATAATAAGACACCATAGGATTCTGAATTTACCATGATATAAGTTAAGAAGATTGATATCTGTC 386 MR1874 Reverse 157627 157829 203 119.4 CUGUAAGUAAGGAUAUUGUUGU UAAUGUUGACUACUUUAGAGAU
387 AACAAATGAAACACGTAGCTGTTGTTTTTTGGTGAATATAGTTTGGTAAGTCCTTAGCGGGTAAGTTCTAAGAAACATTAGTTACTTTTTATTGTT 82 MR1880 Reverse 158066 158161 96 147.5 UUGUUUUUUGGUGAAUAUAGUU UAAGAAACAUUAGUUACUUUUU
388 ACGAATTTTTTTTTCGTCCATGTATGTGATTACGAGTAGTAGTGGTATGTAGAACAAGAAGAAAAATCGT 255 MR1902 Reverse 160476 160545 70 126.8 GAUUACGAGUAGUAGUGGUAUG UAUGUAGAACAAGAAGAAAAAU
389 GCCATGGCCTTCGTGCTGTGCGGTGGTCTTTTGTCTCTTCGCCTCCCGGAGGGGAGGAGAGCCTACAGACGGGACGACACATAGCGCACGAAAAAGCACATGGT 105 MR1919 Reverse 162789 162892 104 143.6 UGGUCUUUUGUCUCUUCGCCUC ACGGGACGACACAUAGCGCACG
390 CGCCGTCGCCGCCGCCTCGGACTCCTGCACCGTCTCGCCCGCGCTGTGGGCGCTGCTGGGTCGAGGGAGCGAAAGAAGTGACGACGGCG 412 MR1924 Reverse 163167 163255 89 117.3 CCCGCGCUGUGGGCGCUGCUGG UGGGCGCUGCUGGGUCGAGGGA
391 CGGCTGTTTCTACCACCGCCACCACCGCCGCCGCCTCCTCGGGTATTGTTCCGGGCCCGACCCCGACGTCCGCCCGGCGGTGGTGGTGGCGGCGGCAGTGGAGCCG 175 MR1931 Reverse 163800 163905 106 134.4 UACCACCGCCACCACCGCCGCC UCCGCCCGGCGGUGGUGGUGGC
392 CCGCCGCCGCCTCCTCGGGTATTGTTCCGGGCCCGACCCCGACGTCCGCCCGGCGGTGGTGGTGGCGG 345 MR1932 Reverse 163814 163881 68 121.8 CCGCCUCCUCGGGUAUUGUUCC UCCGCCCGGCGGUGGUGGUGGC
393 TCGTTGTCCTCGTCCTCATGGCGGTTGTTTCTCCGTCGCGATCTCCGAGAGGAGGAAGACGACGA 100 MR1934 Reverse 163922 163986 65 144.3 CCGCCGCCUCUCCGUCGCGAUC AUCUCCGAGAGGAGGAAGACGA
394 TGGGCGCGACGCGGCGTGCTGCTGCTCAATACCGTGTTCACCGTGGTGCACGGACAGCCTGGATCTCACCGTCACTTAGGCTGGCAGACGCTGAGTAACCATGTGATCCGGAGGCTGTCAGAGCGCCGGGAGCATCTGGTGTTCATGCTGTGGGGCGCCGACGCGCACA 27 MR1940 Reverse 164465 164633 169 164.1 CCUGGAUCUCACCGUCACUUAG AGUAACCAUGUGAUCCGGAGGC
395 GTTGAGCTCGGACACAGCGCCGCGCTGGATGACGGTGATGCGCGGCTACAGCGAGTGCGGCGATGGCTCGCCGGCCGTGTACACGTGCGTGGACGACCTGTGCCGCGGCTACGAC 120 MR1951 Reverse 165370 165484 115 140.6 GUGAUGCGCGGCUACAGCGAGU UCGCCGGCCGUGUACACGUGCG
396 GAGGGTGACAAGTATGAAAGTTGGCTGCGCCCGTTGGTGAATGTTACCGGGCGCGATGGCCCGCTATCGCAACTTATCCGTTACCGTC 410 MR1955 Reverse 165591 165678 88 117.4 UAUGAAAGUUGGCUGCGCCCGU GGCGCGAUGGCCCGCUAUCGCA
397 GCCACAGGCCGTAGCCACGTTCAAATTCTTTCACCAGGATCCCAACCGCGTTCTGGACTGCATCCGTCCGGTGGTGCCGCGCTCTACTTCGTACCACGAGACGGGTGTATACCAGATGTGGGTCTCGGGCGCCACCAAGAAAGACCTGTTCGACGCCGTAACCCTGTGCGC 161 MR1967 Reverse 166923 167093 171 135.7 GCAUCCGUCCGGUGGUGCCGCG CGAGACGGGUGUAUACCAGAUG
398 TCCGCACCTGCCGTGTCGACGCCGACCTAGGACTCCTGTACGCCGTCTGTCTGATCCTGTCGTTCAGCATCGTCACGGCGGCCCTGTGGA 344 MR1998 Reverse 170075 170164 90 121.9 CUGUACGCCGUCUGUCUGAUCC AUCCUGUCGUUCAGCAUCGUCA
399 GTGGTGGGAGATCCAGTATTCATCGGGTCGTCTCACCCGAGTCCTGGTCTTTCATGATGAGGGTGAGGAGGGTGATGACGTACATCTCACGGATACCCATCAC 265 MR2002 Reverse 170310 170412 103 126.3 UCAUCGGGUCGUCUCACCCGAG UGAGGGUGAGGAGGGUGAUGAC
400 CTCTTGCGCCCTCTCGGTGTTGGACCAAAGACTGTGGTGGGAGATCCAGTATTCATCGGGTCGTCTCACCCGAGTCCTGGTCTTTCATGATGAGGGTGAGGAG 4 MR2004 Reverse 170343 170445 103 187.0 AAAGACUGUGGUGGGAGAUCCA CGUCUCACCCGAGUCCUGGUCU
401 TCTGGTCTCCTGATGTGGGGGTGCGGGTGGTCCCGGATACTTGTCCTTCTCCTCCTCATGTGTATGGCCCTGATGGCGAGAGGCACATACGGGGCTTACATCTGCTCCCCCAACCCAGGGAGACTTAGA 276 MR2005 Reverse 170448 170576 129 125.3 GUGGGGGUGCGGGUGGUCCCGG CUGAUGGCGAGAGGCACAUACG
402 CGCGGCGGTTTTGGTGGCGCGGCCTCCTCCTCTCTGCTGAGCTGCGGCCATCAGAGCAGCGGCG 284 MR2012 Reverse 171483 171546 64 125.0 UUUGGUGGCGCGGCCUCCUCCU UGAGCUGCGGCCAUCAGAGCAG
403 GATGAAATGCAGCAGTGGCGGAGGAGCATCCGTGACCTCGAGCCACCATGGGCGCGGCGGTTTTGGTGGCGCGGCCTCCTCCTCTCTGCTGAGCTGCGGCCATC 172 MR2013 Reverse 171495 171598 104 134.5 GAGCAUCCGUGACCUCGAGCCA CGGUUUUGGUGGCGCGGCCUCC
404 CAAGTTGGCACATGGCCAATGCATATCGATATATATACATTGAATCAATATTGGCCATTAGCCATATTAGTCATTGGTTATATAGCATAAATCAATATTGGCTAATGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATG 102 MR2058 Reverse 175659 175828 170 143.9 UAUCGAUAUAUAUACAUUGAAU AAUAUUGGCUAAUGGCCAUUGC
405 CGCGTTTCGAGATTTCTGTCGCCGACTAAATTCATGTCGCGCGATAGTGGTGTTTATCGCCGATAGAGATGGCGATATTGGAAGAATCGATATTTG 272 MR2063 Reverse 176062 176157 96 126.0 CGCGAUAGUGGUGUUUAUCGCC AUCGCCGAUAGAGAUGGCGAUA
406 GTGCATGGAACGGAATTACGCTGCAAATGTCTTGATGGTAAAAAACTGCCGCCCAAAACAATTATGTTGGGTAATTTTTGGTTTCATCGC 451 MR2119 Reverse 181146 181233 88 115.4 GAUGGUAAAAAACUGCCGCCCA CCCAAAACAAUUAUGUUGGGUA
407 GAGAGAAATTCAGAGCTGTCATTGTAGAATTAGTCTAGATTCCTGATAATAAATGGTATCGATTTTGAAACCTAATTGACGTGTGATCGATTTTTAAACCTGTGTGTTGTATGATTGATTGGTATGTGGGGGGATCCGATTTCAAAGGGGGGTACTTATCGGGAATTGATGTGTCATGGACGCAGTTTTGAGTGATTTTC 419 MR2124 Reverse 181347 181546 200 116.6 AUUCCUGAUAAUAAAUGGUAUC UGUAUGAUUGAUUGGUAUGUGG
408 CATCAGTAGTCCCAGCGTTATGGTTAATTTTAAGCATCATAACGCTGTGCAGCTGTTG 378 MR2130 Reverse 181876 181933 58 119.6 GUAGUCCCAGCGUUAUGGUUAA AUCAUAACGCUGUGCAGCUGUU
409 GTGGACTTTGTAGTATGCGGGTTAGTGAAGTTATGTCATTTATTTACGTTTACGATCTCGTATTACAAACCGC 209 MR2147 Reverse 182793 182865 73 130.8 UGUAGUAUGCGGGUUAGUGAAG UACGAUCUCGUAUUACAAACCG
410 TCCGCTGTTGCGAGCTGTACGGGGAATACGAGCGCCGGTTCGCGGACCTGTCGTCGCTGGGCCTCGGCGCCGTACGGCGGG 136 MR2200 Reverse 187728 187808 81 139.3 UGUACGGGGAAUACGAGCGCCG UCGUCGCUGGGCCUCGGCGCCG
411 TTTTTTCCTGTGTTAACACCGGCGTTTTCGGGACGGTCGGTTAACGTGGGTTTCAGGGGAAGGCTGTAAGCACGGGGAAGGA 92 MR2248 Reverse 191726 191807 82 145.7 GUCGGUUAACGUGGGUUUCAGG AAGGCUGUAAGCACGGGGAAGG
412 CGGTGTTTGTGCGGCGTTTCTACGCAGCTTTTGCGCAGCGCTTCGCTTTTCGGGGCGGCGACGGCGTTGTTTTCGGGCGTGCTGGGCGCCGGCGCCG 89 MR2275 Reverse 194684 194780 97 146.0 ACGCAGCUUUUGCGCAGCGCUU CGGCGUUGUUUUCGGGCGUGCU
413 CCGGGGACGGGGTGTTGCGGGCGCTCGGGGGTTGGCGGCGGGTGTTTCTACGGTGTTTGTGCGGCGTTTCTACGCAGCTTTTGCGCAGCGCTTCGCTTTTCGGGGCGGCGACGGCGTTGTTTTCGG 387 MR2276 Reverse 194705 194830 126 119.3 GGCGCUCGGGGGUUGGCGGCGG AGCUUUUGCGCAGCGCUUCGCU
414 GCTGAGGGAGTGTTGCGTGACATAAGTAAGCGCGTCGGCGTCCTCAGCGCGTTTGCGGCGTGCTGTGTCCGGCGCTTTGTGCGCACTGCCGTTGCGTGGCGTCCCGCGGT 432 MR2277 Reverse 194852 194961 110 116.2 UCAGCGCGUUUGCGGCGUGCUG UGUGUCCGGCGCUUUGUGCGCA
415 CCCGGAGGAACACGCGCAACAGGGCCGCGGACTGGGTCCCCGAGCGCGCACCCTCCTAGGTGGACGCCCGACATCCATTCCGGGCCGTGTGCTGGGTCCCCGAGG 367 MR2282 Reverse 195637 195741 105 121.0 CGGACUGGGUCCCCGAGCGCGC UGGACGCCCGACAUCCAUUCCG
416 GCTCCCGTCCGAGCGCCGTCGCCTCCTCGGCGCGCAGCAACGTCTGTCGGAGCGCCGGCTGAGGCAGCAGCGTCGCGCGCGGGGTGC 408 MR2299 Reverse 196742 196828 87 117.4 CGCCUCCUCGGCGCGCAGCAAC GAGCGCCGGCUGAGGCAGCAGC
417 GGTGCCGACGCACGGCCGTCAGCAGCGACGCGGGGTGCGGCGCCGACGCGAACGGCTCGTACTGCGCCAGCTCCTGCCACGCGCCCAGCAGCACC 340 MR2302 Reverse 196893 196987 95 122.1 UCAGCAGCGACGCGGGGUGCGG GCUCGUACUGCGCCAGCUCCUG
418 GCCATCGCGCACGGCGCGTCCCCGCCGGCGGCCTCCGTCTCCGTGCCGCTCGCCGCTGGCGGCGACGTCGTCCCCGTCGCCGGC 396 MR2304 Reverse 197064 197147 84 118.9 CACGGCGCGUCCCCGCCGGCGG CUCGCCGCUGGCGGCGACGUCG
419 CTCATCATCGTATCGGAGCGCATAGCTGACGCTTGCCTGAGCACTGAGCGGTGGGGGCATCGTTGCAGCGTCCGGTTTGGTTTGGCGAGATGGG 425 MR2312 Reverse 197817 197910 94 116.6 CAUAGCUGACGCUUGCCUGAGC GGGGCAUCGUUGCAGCGUCCGG
420 TCGGCGCCTCGTCGTTGAGTGGCCTTCAGCAGTCTGCGTTGTTTTATATCGTCGGGTCGGCTGTCCCCGAGGACCCAATGTGATTCGTCGAGATCCAACCAGGCTTTGTGGTCGTCAACTGTGCTGAGCGGGCGCC 241 MR2316 Reverse 197915 198048 134 127.9 GUGGCCUUCAGCAGUCUGCGUU AACCAGGCUUUGUGGUCGUCAA
421 GGCCGCGGTTCTATCCCCGAATTTGGGCGGTGGCGGTCTTGGCGGTCGGGTCTGTCTTTTATGATGCTCCGACTGTCGGGGCGCAGAAACTTTTCCGTCGGTGGAACCGTGCC 45 MR2318 Reverse 198278 198390 113 154.6 UGGCGGUCUUGGCGGUCGGGUC CUCCGACUGUCGGGGCGCAGAA
422 TGTTGCTGTATGGACTGGAAGGCGCACGTTGAGTACGCGCATCCTGCGTCGGAGCTCAGACCGGGCTCCGGCGGGTGGCCTGAGCACGCCGAGGCCCAGTGGCGGCAGCA 390 MR2324 Reverse 198805 198914 110 119.1 UACGCGCAUCCUGCGUCGGAGC UCCGGCGGGUGGCCUGAGCACG
423 TTTCAATAAATGTAGCCACGAGCACCCATTACGTATGTCATGTCGGTTTCGTTTATTGGAA 438 MR2332 Reverse 199249 199309 61 116.1 UAAAUGUAGCCACGAGCACCCA UCAUGUCGGUUUCGUUUAUUGG
424 GCGGGATATGGACTCGGAGGCGCCCGGTAGGTCAGCATGTCTGATACCGGGCGCCGGGACTCTGGTGCTATGGCTGC 252 MR2343 Reverse 200201 200277 77 127.0 UGGACUCGGAGGCGCCCGGUAG CGGGCGCCGGGACUCUGGUGCU
425 GGCCGCGGGATATGGACTCGGAGGCGCCCGGTAGGTCAGCATGTCTGATACCGGGCGCCGGGACTCTGGTGCTATGGCT 286 MR2344 Reverse 200203 200281 79 124.8 AUGGACUCGGAGGCGCCCGGUA ACCGGGCGCCGGGACUCUGGUG
426 CCGCATGGGAAAGTACGGTGTCGCCACCGTTGACGTGGGCGGCGATGAGAACGTCAGCGGTGGCGAAACCGCCGTGTGG 302 MR2358 Reverse 201169 201247 79 124.1 GUGUCGCCACCGUUGACGUGGG GUCAGCGGUGGCGAAACCGCCG
427 TGTCGCGACAATCGCCGACAAGCCGGCCCGTTGTGTATGCATGTCGCGACAGAGAGGTGTAGCGGGCTGTCACATCAACTCTATCGCGACAGACATCCCCCTGCACGTCCATGTCGCGACACGACCACTAATCCGCACCTGTCGTCGACATGTCGCGACA 151 MR2361 Reverse 201327 201486 160 137.9 CGACAGAGAGGUGUAGCGGGCU UGCACGUCCAUGUCGCGACACG
428 CGGGATTGTTATGAACGCTTCGTGTGCCCGGTATACGATTCCGGGACGCCGATGGGCGTTTTGATGAACTTG 267 MR2413 Reverse 205422 205493 72 126.1 UGAACGCUUCGUGUGCCCGGUA GGGACGCCGAUGGGCGUUUUGA
429 TTGTTCGAAGATCGCCGTCTAATGGCGTACTACGCGCTCACGATTAAGTCGGCGCAGTATACGCTGATGATGGTGGCAGTGATTCAA 372 MR2420 Reverse 206001 206087 87 120.3 CGUCUAAUGGCGUACUACGCGC CGCAGUAUACGCUGAUGAUGGU
430 GCTATAAGATAGCCTTACAGCTTTTGAGTCTAGACAGGGGAACAGCCTTCCCTTGTAAGACAGAATGAATCTTGTAATGCTTATTCTAGC 246 MR2421 Reverse 206551 206640 90 127.6 AGGGGAACAGCCUUCCCUUGUA UUGUAAGACAGAAUGAAUCUUG
431 GGACGTTGTTCGTGGCCTGCAACGGCGTGGCTTGGGAACACCGCCTCAGCTCTGTGTGGCGTGACGCGCTTTTCACCTCCACACTTTTGACGGTGATGGTCAGCGTCC 253 MR2449 Reverse 208882 208989 108 126.9 CUUGGGAACACCGCCUCAGCUC CGUGACGCGCUUUUCACCUCCA
432 CTCGCCGGCCTCCTGGCGCACATCCCGGCGCTAGGTGTCACGTGTGCCTGCCAGGAGCCCCGCGAG 103 MR2476 Reverse 210837 210902 66 143.9 UGGCGCACAUCCCGGCGCUAGG CGUGUGCCUGCCAGGAGCCCCG
433 CTTTGTATGCGGGTCTACAGCACCGTGGCCGTGCAGGGCACCTGCACCTTCTTGCTCTGTCTGGGCCTGGTGCTGGCTTTTCCGCATCTTAAAG 395 MR2489 Reverse 212114 212207 94 118.9 ACCGUGGCCGUGCAGGGCACCU UUGCUCUGUCUGGGCCUGGUGC
434 GGGCTTTTGCGGAGAAAGGCGCGTCATCGGTCTGTCGTTTGCCCTGGTGATGGTCTTTTTCGTTCTCTGCAGCGGTCT 266 MR2498 Reverse 212959 213036 78 126.3 UUGCGGAGAAAGGCGCGUCAUC UGGUGAUGGUCUUUUUCGUUCU
435 CTGGCGGTAGATCTCAGCTGCCTGGGGGCCTCGCTTTTGGGTTGCGATCCTGGCGCGTCTCTCCGGCGGCTGTGGCTACCGTCGG 49 MR2511 Reverse 213799 213883 85 154.1 UCAGCUGCCUGGGGGCCUCGCU CGCGUCUCUCCGGCGGCUGUGG
436 GAGTGCCAGTACAGCGCCGACGTGCTTCGCGACTGGGTCCGTAACCACGTCGACCAGGTGTTGTCGCTCGGCATTC 360 MR2584 Reverse 219526 219601 76 121.3 CCAGUACAGCGCCGACGUGCUU UAACCACGUCGACCAGGUGUUG
437 GAAGCAGCCGAGCGCGAGGCCGCTGGTCATCAGGACGATACGGGCCCGCGGCTGCACTGCCTGGTGACGACGCGTTCGTCGACGCGCGAGGGCGCAGAGCGGGTGATTACCGCCCTGGTGCATCAGTCGCGGTTAGTGACGTACTCGGACCCTTT 348 MR2590 Reverse 219863 220017 155 121.7 AGGCCGCUGGUCAUCAGGACGA CGCGCGAGGGCGCAGAGCGGGU
438 GCCGGGGCTGTGAACCGCTCAGTGGCTCGGACCGCCGGCTGTTTCTGCGCACCGGTCCGAACGCTAGGTCGGTTCTCAGACCGAGGC 112 MR2603 Reverse 221465 221551 87 142.5 CCGCUCAGUGGCUCGGACCGCC CGGUCCGAACGCUAGGUCGGUU
439 CCGACGGACGCGATTCGGGGTCCTTCGGTTAGCGGTCTGTTCAGGTGGATGAGGGCTCTTCACGGTCGGGCACCCGGCTGTGCCTGTCATCCACTTGGAGAGCTCCCGCGGTCCGATTGGCCCTCCACAGGCGCGTTGGACGGGGCGTCGG 94 MR2607 Reverse 221640 221790 151 145.3 CGGUCUGUUCAGGUGGAUGAGG UGUGCCUGUCAUCCACUUGGAG
440 GGGTCGCTGCCCTCACGAAAACTTTCCCTTCTGGGACCGCTTTGGGACCGTGGAGCGTGTACGGGCCTCTACACGCCATCACGAACTACGTTATAAATGGTTAATCCGCAAGGACAGGTTTATCGTCCGACCC 444 MR2618 Reverse 222592 222724 133 115.8 AAACUUUCCCUUCUGGGACCGC UCACGAACUACGUUAUAAAUGG
441 GTCGCTCGAGTCTCTGGGCGTCCTGCAGTTCTCTACCACCGTGTTGCCCAGAGTACACGGGCCGC 374 MR2630 Reverse 223443 223507 65 120.1 UCGAGUCUCUGGGCGUCCUGCA UGUUGCCCAGAGUACACGGGCC
442 GGCGTCTAGATTTTGTAGAGTTTGAGGACATCTTTGGCAGCGCGGCTGTCACCGACGGGCCCGAAACGCCCTGGGGTCAGCTCATCTGCTGCGAAGAGTCGCTCGAGTCTCTGGGCGTC 152 MR2631 Reverse 223486 223604 119 137.7 GAGGACAUCUUUGGCAGCGCGG AGAGUCGCUCGAGUCUCUGGGC
443 GGTGCTATTCAAGGTGTGATTCGTTACGTTGCTCACCTGTAGCATGATATTAGTGGTAGTTGTAGTAGATGTAGTCATTACCTTGCAGGTAGTATC 154 MR2638 Reverse 224115 224210 96 136.9 CUAUUCAAGGUGUGAUUCGUUA UAGUCAUUACCUUGCAGGUAGU
444 GGACCACGGTTGATTGTGCCCGGACCGTGGGCGCGACGAAACCCACCGTCACGGTCCGAGCACATCCAAACGTGAGCC 77 MR2670 Reverse 226702 226779 78 148.3 GAUUGUGCCCGGACCGUGGGCG ACGGUCCGAGCACAUCCAAACG
445 GGTACGGTGGCGGCGGACTGTCAGGTATCCGCGTGGACGGAAACGGCGGTAGTGACCAGGTGGTCAGTGGCGGCGACAAGGCCGCCTGAGCCGGTAGCTCCTTCTTTTCCCCAGGTGGTGCGACTGACGGTGGCGGCGGCAGACC 48 MR2680 Reverse 227601 227745 145 154.3 UGUCAGGUAUCCGCGUGGACGG CCUGAGCCGGUAGCUCCUUCUU
446 GCTACAGGAGGGGGCAGCACAATCAGCTGATGTGTGGACGGAAAGGGTCGCGCCTCAACGTTCCAGACCAGAGCAGACTGTCGTTTCTTCTCTTCCTGCAGT 275 MR2696 Reverse 228738 228839 102 125.4 ACAAUCAGCUGAUGUGUGGACG AACGUUCCAGACCAGAGCAGAC
447 GCTACTTTCCCCACAGTTAGACGGAGTGTATCGAGCTCGCCGGCGGCGAAACAACCAGCGCCGGGTACTGTGGCGCAGTCGTTTCCACCAGGTGAACTTGCTCTCCGCGACGAAACCGGAGGAAGAGGC 369 MR2706 Reverse 229291 229419 129 120.8 GCCGGCGGCGAAACAACCAGCG AGUCGUUUCCACCAGGUGAACU
448 GCTGCTGCCCGAGCTGGACCGCGAGCAGTGGGAGCGGCCGCGCTGGGACGCGCTGCACCTGCACCCGCGCGCCGCGCTGTGGGCGCGCGAGCCGCACGGGCAGTTAGC 184 MR2742 Reverse 233105 233212 108 133.0 CUGCCCGAGCUGGACCGCGAGC CACCCGCGCGCCGCGCUGUGGG
449 GGCGGCGGAGCTGTCGCACTTTCTGCGCGCGGGCGTGCTGGGCGCGCTGGCGCTGGGGCGCGAGTCGGCGCCCGCCGCC 180 MR2745 Reverse 233227 233305 79 133.4 GGGCGUGCUGGGCGCGCUGGCG UGGCGCUGGGGCGCGAGUCGGC
450 GTGCCGCGCGCCATGCTGGTGGTGGTGCTGGACGAGCTGGGCGCCGTGTTCGGGTACTGCCCGCTGGACGGGCACGTGTACCCGCTGGCGGCGGAGCTGTCGCACTTTCTGCGCGCGGGCGTGCTGGGCGCGCTGGCGC 259 MR2746 Reverse 233253 233391 139 126.6 CUGCCCGCUGGACGGGCACGUG CGGGCGUGCUGGGCGCGCUGGC
451 GTCCGACGGCGATGGCGGGTCCGGCGGCGTCGGGGACCGTGCCGCGCGCCATGCTGGTGGTGGTGCTGGACGAGCTGGGCGCCGTGTTCGGGTACTGCCCGCTGGACGGGC 198 MR2747 Reverse 233319 233429 111 131.5 CGCGCGCCAUGCUGGUGGUGGU UGCUGGACGAGCUGGGCGCCGU
452 GCGGGTCCGGCGGCGTCGGGGACCGTGCCGCGCGCCATGCTGGTGGTGGTGCTGGACGAGCTGGGCGCCGT 364 MR2748 Reverse 233345 233415 71 121.0 UGCCGCGCGCCAUGCUGGUGGU UGGUGGUGCUGGACGAGCUGGG
453 CGGCAGCGGCAGCAGCGGCGGCGCCGACGGTGATGGTGGGTCCGACGGCGATGGCGGGTCCGGCGGCGTCGGGGACCGTGCCGCGCGCCATGCTGGTGGTGGTGCTG 145 MR2749 Reverse 233362 233468 107 138.2 ACGGUGAUGGUGGGUCCGACGG UCGGGGACCGUGCCGCGCGCCA
454 CAGCCGATGGTGCTGCTGGGCGCGTGGCAGGAGCTGGCGCAGTACGAGCCGTTCGCGTCGGCGCCGCACCCCGCGTCGCTGCTGACGGCCGTGCGTCGGCACCTGAACCAGCGTCTGTGCTGCGGCTG 19 MR2753 Reverse 233723 233850 128 169.0 UGGGCGCGUGGCAGGAGCUGGC CUGCUGACGGCCGUGCGUCGGC
455 GCTGATCCTAGCGGCGCGCGACGCGGACGAGTGGTTTCGGCACGGCGCGGGCGAGGTGGTGCGGCTGTACCGCTGCAACCGGCTGGGCGTGGGCACCCCGCGCGCGACGCTGCTGCCTCAGC 70 MR2756 Reverse 233964 234085 122 149.6 CGCGCGACGCGGACGAGUGGUU CCCCGCGCGCGACGCUGCUGCC
456 GGGCGCGACGGACCTGCGTCAGCTGTCGCCGCGGGACGCGTGGATCGTGCTGGTGGCGACCGTGGTGCACGAGGTGGACCCCGCGGCC 199 MR2758 Reverse 234202 234289 88 131.5 CUGCGUCAGCUGUCGCCGCGGG UGGUGGCGACCGUGGUGCACGA
457 GCACACGGCCCGGAATGGATGTCGGGCGTCCACCTAGGAGGGTGCGCGCTCGGGGACCCAGTCCGCGGCCCTGTTGC 404 MR2768 Reverse 235009 235085 77 117.8 GUCCACCUAGGAGGGUGCGCGC CGCGCUCGGGGACCCAGUCCGC